Open Close
General Information
Symbol
Dmel\CG43340-RC
Species
D. melanogaster
Annotation Symbol
CG43340-RC
FlyBase ID
FBtr0306933
Feature type
Associated gene
Evidence Rank
Length (nt)
3851
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 17 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TCATTCGCGTTTCAACCTTCTGCACAAACGGAGTGACGCTCGAAATCGAGGAAACGAAAGCAAACGCTCCCAGGCACACA
        CATACACACACGCACACCATACCAGCAGCAGTACCAGCACCCCGTAGGGGAAGTCTTGAATTTGTGTATCGCGCCGGCTG
        ATAAGCTGCTCCGTAAGCGACTTTTATTTTCGGTGGCCCAAGTGGAGGCAGTGCGGCAGTGCTCGCTTCCAGTAACAAAA
        CAATGCTCGTAACTGGCGCGTAATTAACACACAAAAACGCGCTAAACAAAAAAAACAAACAAACCAAAAGCAGCAGTGAG
        GCGAATTTGTTTGCCAAAAGTGTTTCTTTCATGTGCGTGAATGGAAAACAGTGCCTGCATGAGACACTGAGTGCGGAAAT
        GGAAATGGCCTAGGGCCGCTCCCGATTCACAAGCAACCGACATACACACACACCACACACCGCCCAGCGGCGACAGCAGC
        AGCAACATGGCAGGTGAAGTGCCAGCAGAAACATCGCCAGTAGGATGCAACACCAGCAACAGCCAGGGGAGCAGTCCCCA
        TCCCGATCCCATCCAGCAACAGCAGCTGAACTCCAGCGTGGACAGCGGAATTGCGGTGCTCGAGGCGGAGTCGCCGACCT
        TGAGGAGGCGCCAGCGACTGCACCAGTGCCAACGGATCCTCCAGGTGTTGCAGCGGGATCAACTCACCCACCAGCAGCTG
        CGCGATAGATTAAGCAAACTAGCCAATAAGAAGTGGAGGAAGGAGGAGTCCAGCAGCGAGGATCACGCCTGCAACGTCTG
        CTGTGCGGACCTGGATCTGAGCAGTGCCAAAAACTACGTGACATGTTGCACCTGCGAAAAATCGGTTTGCCGCGGGCCTA
        AATGCGCCGACTGGCGGCCCAAGGACGCCAAGTGGGAGTGCCAGCTGTGCCAGAGCTCCAAGGAGTCGCTGGCCCACACC
        TCCTCGTGGGTGGCCGAGCAAATGTCCTTCAACCAGCATAAGTTTGTCTATCCGATGAGGGCTAGGAGCGAGGTGTATAT
        ACCGATTGTGGGCGATGGCAACGACAGCAGCATGCAATTCGAGAGCGTTAGCCAGATTGGACAAAACGCCCACATGGACG
        AACGGGCCAAGATCCGCGAGTACGTCGAGGAGATTGTGGCCGAAATGCTGGGCGGCAATTTGGACCACGTCAAAGTGGGG
        CAGCTGTCCAAGAGTGAGAACTATCTGCCGGCCATCGTAAATGGCCATACCAACAATAGTAATAATAATAATAACAACAA
        CCATGCGGACTCCGAGCTGGCCGACCTCTCGCAGACCCGACTGCGCAGTCTCATCGAGACCATCATAGCGGAGACCCTGC
        GGAGCTCCACCCTCAGCGCCAGCGGAGCCGTCTCGGAGATCAGCCTGGACACCAGGTCTCACGTCTCCGATCTGGCCAAT
        GGAAACGGGCTGAAGCGGCGCCATCGCACCGAGCACTACTTCGAGCCGAAGATCTACCAGGATCTGTTGGCCACAGCGGT
        GCTAAATAAGATTGTGGATAAGGAAGGGAATACAAGGCTGGCGGCGGAGAGTACGCCGGACTTGAGTGGTCGCCACATTG
        ACGAGAATTTCAATGCCGAAGCGCTGAGCACCACGTCCGGAAGCTCCATTGAACCACGGAGTGATTGCAGCCTCACCGAT
        CATGAAATCGGACTGGATAATGGCAAATCCCAATCCCTGCAAACGGACTTGGAAAGGGAATCCGTGCTTAGTGACTATAT
        AGCCGCACACATGGTGCCACTGCCGGACTTTTCAGCATCCGTCACCGAATCCGAGGATGATATTGGATCCATCTCCTCGG
        GCATGATCGGAGATGGAAACTGGGAGGACAACTGGCTGTTCAAGAAGAAACGCAGCTCGGCCACTCCGAGCAGCATTGGC
        ATGCTGGTGCCGGCACCAAGGGAGAATGTACGTGCCCAGATTGGGGATAAGACCACCGACGAGGTGAGCGATCTCTCCGA
        GATTGGTTCGGACATCGAGGAGAGCTCTCTGGATCTGCTGCGATGCAATGATCTCAACGATCGTCTGCTCAGCAAGCACC
        TTATTGGTGGGCAAAACACCAAGATGGTCCTCGACGAGCTCGTAGATCGCACCAGTCTCACGTCCCACACATTGCCGGAG
        GAGAATGAGCCCGCATTCACAGAGACAACCAATGAGTTTGTGGTATCCCCGATGGCCATGCCTTCTGATATAAAGGCGCC
        TTCTCCGACGCCACCTCCGCCACCAATGATATTCCAGGATGACTTGTTGAACGAGGAACCAGACCACACTCCCATCGCAG
        GTTCCATTGCGGAACGCGAGGTGAAGAAGTGGTACAACGCCGTTGAAATGCCAAATAATCCGTACTCCCCGGAGGCCCTG
        AAGCAGCGCATCAGCGGCACCCAGGAGCGCTACATGGATGTGCCCAACATCAGTCCGAGTGCTGAGCAAAAGGCACTGGC
        TTCGGCGCTGACGGAAAATCCGGATCCGCCAGCGCCCAAAGCGGATTATAAGCGCTATAGCCGCGACTACTACATCAACA
        ATGCTCCCACATCCACTGACAGCACGGGGGGTGGAAAGGCCGCCACAACCAGCGCAGGCGAGGATGTGGAGGACATCGTG
        ATCAACGAGGTAAATCAAGAACCAGAACCACATCCACCGCATGGCCGCATTTCAAGTGGCGCTCAGAGCACCGCTGCCGA
        CCTCTCTCATTGGACCCTATCCACGCCAGTGCGACGCAGTAGCTCACTAAAGTTCATTAACAGCCGCCCCTTCCACTCCC
        CCTCCCCCTCGCTGGGCTACGAGAGATCGGTGCCCCTCGAGCGACCTTCGACCTCGGCGTCCCATTACCGCGAATCGAGT
        CTGGGTTTGGGTGACGACGACGACTTTGACCTGAGATCGCAGCGCTCCTGGCGGAGCAGCTACAGTTCACTGCCCAAGCG
        ACACACGCAGTCCTCGCTAAGCCTGCACAGCAATGGTAGCGGGGTGTCCTTTGGCTCGTCCGTGTCCAAGAGACGTCCAG
        CGGCAGGTGGGCCCTCCGCCGGCGTGCTCACCCAGTTCGAAAAGCAACTGCTGCACAAGGACCTCAAGCGGAATAGCTTC
        CGGGCGGTGTCCGCCACATCCAAGGACTTTGTCATGAATCCGCTCTTCGAGAGCGAGCCGCTGGGCGAAAAGCCGGCCCT
        GCGGCCGGAGACGGAGGACCAGGGTGACTCGGGGGTGGACAGCTGCCTGAACGGCTTCAGCGGTGCGGACGCCAAGTACA
        GCAACAATAGTCTGCTATTCTAGGAGCTCTGGGGATCATTTTGGTCTTAGGCCCCACGATATTTGCCAAATTACGCATAG
        CTTAGTCAAACAAACAGATGTTAAACACTAGTCAGTATAGCAAACCCAATTTCTCTGTACATAGCAAATAGGATGGGCAT
        CGGCGGGAATAGAAATTACGAAATTACAACAATATTGAAACACGGGAAATTATGAGGCAGGCACAGAATCTCCCGCACTG
        GAGGGGCAAACGATTCCGACCTTTCCACTGCACCAGCACCTGTTGCACCAACCACGCCACGCGAATGAGAGGATCGAGCT
        AGTGTTCTGATCGTAGCTTTAGTTAATACCACTTACGTAATGCTAATGCCCTAGAGTATGCAACGTTTGTTTTTAATCAT
        TATACTTGCTGTTAATTTTATGAAATAATATGATAAATCCTGTACCGTATCTGTATGCACACCGCTAACGCTCTTTCCAA
        CGAAACACCATACACATATGCCTAGCGATATCTAGAAATCTAGAAATCTATAATGCAGTAATTCCAAATAAAGCCAAACA
        ATAAACCAACC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0306931
        3681
        FBtr0306932
        3947
        FBtr0306934
        3012
        FBtr0306935
        3544
        FBtr0306937
        3384
        FBtr0306936
        3976
        FBtr0306938
        3941
        FBtr0306939
        3248
        FBtr0306940
        3181
        FBtr0306941
        10517
        FBtr0306942
        9266
        FBtr0306943
        9424
        FBtr0331951
        3585
        FBtr0331952
        8164
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0297786
        938
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0297784
        983
        FBpp0297785
        1020
        FBpp0297787
        723
        FBpp0297788
        983
        FBpp0297790
        847
        FBpp0297789
        1020
        FBpp0297791
        968
        FBpp0297792
        723
        FBpp0297793
        723
        FBpp0297794
        3213
        FBpp0297795
        2796
        FBpp0297796
        2893
        FBpp0304284
        901
        FBpp0304285
        2544
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG43340-RC
        Secondary FlyBase IDs
        • FBtr0088916
        References (0)