Open Close
General Information
Symbol
Dmel\CG43340-RJ
Species
D. melanogaster
Annotation Symbol
CG43340-RJ
FlyBase ID
FBtr0306938
Feature type
Associated gene
Evidence Rank
Length (nt)
3941
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 14 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TCATTCGCGTTTCAACCTTCTGCACAAACGGAGTGACGCTCGAAATCGAGGAAACGAAAGCAAACGCTCCCAGGCACACA
          CATACACACACGCACACCATACCAGCAGCAGTACCAGCACCCCGTAGGGGAAGTCTTGAATTTGTGTATCGCGCCGGCTG
          ATAAGCTGCTCCGTAAGCGACTTTTATTTTCGGTGGCCCAAGTGGAGGCAGTGCGGCAGTGCTCGCTTCCAGTAACAAAA
          CAATGCTCGTAACTGGCGCGTAATTAACACACAAAAACGCGCTAAACAAAAAAAACAAACAAACCAAAAGCAGCAGTGAG
          GCGAATTTGTTTGCCAAAAGTGTTTCTTTCATGTGCGTGAATGGAAAACAGTGCCTGCATGAGACACTGAGTGCGGAAAT
          GGAAATGGCCTAGGGCCGCTCCCGATTCACAAGCAACCGACATACACACACACCACACACCGCCCAGCGGCGACAGCAGC
          AGCAACATGGCAGGTGAAGTGCCAGCAGAAACATCGCCAGTAGGATGCAACACCAGCAACAGCCAGGGGAGCAGTCCCCA
          TCCCGATCCCATCCAGCAACAGCAGCTGAACTCCAGCGTGGACAGCGGAATTGCGGTGCTCGAGGCGGAGTCGCCGACCT
          TGAGGAGGCGCCAGCGACTGCACCAGTGCCAACGGATCCTCCAGGTGTTGCAGCGGGATCAACTCACCCACCAGCAGCTG
          CGCGATAGATTAAGCAAACTAGCCAATAAGAAGTGGAGGAAGGAGGAGTCCAGCAGCGAGGATCACGCCTGCAACGTCTG
          CTGTGCGGACCTGGATCTGAGCAGTGCCAAAAACTACGTGACATGTTGCACCTGCGAAAAATCGGTTTGCCGCGGGCCTA
          AATGCGCCGACTGGCGGCCCAAGGACGCCAAGTGGGAGTGCCAGCTGTGCCAGAGCTCCAAGGAGTCGCTGGCCCACACC
          TCCTCGTGGGTGGCCGAGCAAATGTCCTTCAACCAGCATAAGTTTGTCTATCCGATGAGGGCTAGGAGCGAGGTGTATAT
          ACCGATTGTGGGCGATGGCAACGACAGCAGCATGCAATTCGAGAGCGTTAGCCAGATTGGACAAAACGCCCACATGGACG
          AACGGGCCAAGATCCGCGAGTACGTCGAGGAGATTGTGGCCGAAATGCTGGGCGGCAATTTGGACCACGTCAAAGTGGGG
          CAGCTGTCCAAGAGTGAGAACTACTTGCAACTCTTTGATAAATTCCATGCGAAGCTGAGTAACCTGCTTATCAATGTGGA
          AAACAGTTTGTGCGCGCGTGCGCTCAGGGGAGATCTGCCGGCCATCGTAAATGGCCATACCAACAATAGTAATAATAATA
          ATAACAACAACCATGCGGACTCCGAGCTGGCCGACCTCTCGCAGACCCGACTGCGCAGTCTCATCGAGACCATCATAGCG
          GAGACCCTGCGGAGCTCCACCCTCAGCGCCAGCGGAGCCGTCTCGGAGATCAGCCTGGACACCAGGTCTCACGTCTCCGA
          TCTGGCCAATGGAAACGGGCTGAAGCGGCGCCATCGCACCGAGCACTACTTCGAGCCGAAGATCTACCAGGATCTGTTGG
          CCACAGCGGTGCTAAATAAGATTGTGGATAAGGAAGGGAATACAAGGCTGGCGGCGGAGAGTACGCCGGACTTGAGTGGT
          CGCCACATTGACGAGAATTTCAATGCCGAAGCGCTGAGCACCACGTCCGGAAGCTCCATTGAACCACGGAGTGATTGCAG
          CCTCACCGATCATGAAATCGGACTGGATAATGGCAAATCCCAATCCCTGCAAACGGACTTGGAAAGGGAATCCGTGCTTA
          GTGACTATATAGCCGCACACATGGTGCCACTGCCGGACTTTTCAGCATCCGTCACCGAATCCGAGGATGATATTGGATCC
          ATCTCCTCGGGCATGATCGGAGATGGAAACTGGGAGGACAACTGGCTGTTCAAGAAGAAACGCAGCTCGGCCACTCCGAG
          CAGCATTGGCATGCTGGTGCCGGCACCAAGGGAGAATGTACGTGCCCAGATTGGGGATAAGACCACCGACGAGGTGAGCG
          ATCTCTCCGAGATTGGTTCGGACATCGAGGAGAGCTCTCTGGATCTGCTGCGATGCAATGATCTCAACGATCGTCTGCTC
          AGCAAGCACCTTATTGGTGGGCAAAACACCAAGATGGTCCTCGACGAGCTCGTAGATCGCACCAGTCTCACGTCCCACAC
          ATTGCCGGAGGAGAATGAGCCCGCATTCACAGAGACAACCAATGAGTTTGTGGTATCCCCGATGGCCATGCCTTCTGATA
          TAAAGGCGCCTTCTCCGACGCCACCTCCGCCACCAATGATATTCCAGGATGACTTGTTGAACGAGGAACCAGACCACACT
          CCCATCGCAGGTTCCATTGCGGAACGCGAGGTGAAGAAGTGGTACAACGCCGTTGAAATGCCAAATAATCCGTACTCCCC
          GGAGGCCCTGAAGCAGCGCATCAGCGGCACCCAGGAGCGCTACATGGATGTGCCCAACATCAGTCCGAGTGCTGAGCAAA
          AGGCACTGGCTTCGGCGCTGACGGAAAATCCGGATCCGCCAGCGCCCAAAGCGGATTATAAGCGCTATAGCCGCGACTAC
          TACATCAACAATGCTCCCACATCCACTGACAGCACGGGGGGTGGAAAGGCCGCCACAACCAGCGCAGGCGAGGATGTGGA
          GGACATCGTGATCAACGAGGTAAATCAAGAACCAGAACCACATCCACCGCATGGCCGCATTTCAAGTGGCGCTCAGAGCA
          CCGCTGCCGACCTCTCTCATTGGACCCTATCCACGCCAGTGCGACGCAGTAGCTCACTAAAGTTCATTAACAGCCGCCCC
          TTCCACTCCCCCTCCCCCTCGCTGGGCTACGAGAGATCGGTGCCCCTCGAGCGACCTTCGACCTCGGCGTCCCATTACCG
          CGAATCGAGTCTGGGTTTGGGTGACGACGACGACTTTGACCTGAGATCGCAGCGCTCCTGGCGGAGCAGCTACAGTTCAC
          TGCCCAAGCGACACACGCAGTCCTCGCTAAGCCTGCACAGCAATGGTAGCGGGGTGTCCTTTGGCTCGTCCGTGTCCAAG
          AGACGTCCAGCGGCAGGTGGGCCCTCCGCCGGCGTGCTCACCCAGTTCGAAAAGCAACTGCTGCACAAGGACCTCAAGCG
          GAATAGCTTCCGGGCGGTGTCCGCCACATCCAAGGACTTTGTCATGAATCCGCTCTTCGAGAGCGAGCCGCTGGGCGAAA
          AGCCGGCCCTGCGGCCGGAGACGGAGGACCAGGGTGACTCGGGGGTGGACAGCTGCCTGAACGGCTTCAGCGGTGCGGAC
          GCCAAGTACAGCAACAATAGTCTGCTATTCTAGGAGCTCTGGGGATCATTTTGGTCTTAGGCCCCACGATATTTGCCAAA
          TTACGCATAGCTTAGTCAAACAAACAGATGTTAAACACTAGTCAGTATAGCAAACCCAATTTCTCTGTACATAGCAAATA
          GGATGGGCATCGGCGGGAATAGAAATTACGAAATTACAACAATATTGAAACACGGGAAATTATGAGGCAGGCACAGAATC
          TCCCGCACTGGAGGGGCAAACGATTCCGACCTTTCCACTGCACCAGCACCTGTTGCACCAACCACGCCACGCGAATGAGA
          GGATCGAGCTAGTGTTCTGATCGTAGCTTTAGTTAATACCACTTACGTAATGCTAATGCCCTAGAGTATGCAACGTTTGT
          TTTTAATCATTATACTTGCTGTTAATTTTATGAAATAATATGATAAATCCTGTACCGTATCTGTATGCACACCGCTAACG
          CTCTTTCCAACGAAACACCATACACATATGCCTAGCGATATCTAGAAATCTAGAAATCTATAATGCAGTAATTCCAAATA
          AAGCCAAACAATAAACCAACC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0306931
          3681
          FBtr0306933
          3851
          FBtr0306932
          3947
          FBtr0306934
          3012
          FBtr0306935
          3544
          FBtr0306937
          3384
          FBtr0306936
          3976
          FBtr0306939
          3248
          FBtr0306940
          3181
          FBtr0306941
          10517
          FBtr0306942
          9266
          FBtr0306943
          9424
          FBtr0331951
          3585
          FBtr0331952
          8164
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0297791
          968
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0297784
          983
          FBpp0297786
          938
          FBpp0297785
          1020
          FBpp0297787
          723
          FBpp0297788
          983
          FBpp0297790
          847
          FBpp0297789
          1020
          FBpp0297792
          723
          FBpp0297793
          723
          FBpp0297794
          3213
          FBpp0297795
          2796
          FBpp0297796
          2893
          FBpp0304284
          901
          FBpp0304285
          2544
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG43340-RJ
          Secondary FlyBase IDs
            References (0)