Open Close
General Information
Symbol
Dmel\bowl-RG
Species
D. melanogaster
Annotation Symbol
CG10021-RG
FlyBase ID
FBtr0307028
Feature type
Associated gene
Evidence Rank
Length (nt)
3394
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 36 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GTGGCTCAGTCTTCGAGAGTTGATCGTGGCCAACGCACCTGCGCGCGGATCGCTGAATCGTATTAACAGAAGTCTTCAAA
          CAAATACAACAAGAAAAAACAACATACAATTCAAGTGCCACTTAAATGATATAAATTACTACTTTAAAAACCAAAAACAA
          TGCCAAGCATTTCAAAGCTTACAAACTGACAAAAAACCAGCAAAATCATATTGAAACAACTACTTGGATACTTTAGGACG
          CAAAGATAAAGCCCAAAGAGCCTGGGGCTTTCTTCTGTTTAACCCACAGTTCCAACGGAATGTGAAGAGCCCCTCCAATA
          TAATGCCCACGGAAAGCTCATCCAGCGAGATCTCCGGCGGAGGAGGCGGTGCGATACCCATGCTGCGACCTTCCCGGATG
          GATCAGTTCATGAACTCGATGGCGGCGGCAGCGGCGGCGGTGGGTGGTGGCGGTCTTCCTGGTGCGGCGGATAGGAACGG
          CGGATCCGGAGGATCGGATGGTGGCTCCCAGAATGGCAACGGCGATTCGCGCAACTCATCGGCCAGCCGGATCTCAGCGT
          ATGAAACACAGCTGGCCTATCAGCAGCATTTGGCCGGACTGCATGGTCCGCCGCCACCGCCACCACCATCGCATCATCGC
          GAGATCTCTGCCTTTGTGCCGGTTCTGCCCACCGGAAAGGTGCGCCCGGGTAGTAATTCCAATTACGAAATCATTGCCAT
          GATGGCGGACAAGCGAAAGGAGTTGGCCCTAAGGGAGGCGGCTGCGGCGGCGGCAATGTTAGGACGAGGTCCTGGAGGAC
          CCGGCGGTCCTGGTGTGCCACCGCCTGGAGTGTTGTACGGACCAGCTGGCGTGCCACCTCCGCCATATCTCACCGGACCG
          GGTCCATCGCCCACGGGAGCCGGAAGTTTTCCATTTCCACCAGGAGCCGCCGCCGCAGCTCTATTTCCACCTGGCCTGGG
          TCCTGGAATGCATGCCGGACTCGATAGGCGCCTGCTACGTGCTCCTGGTCGGGCATCGCGGCCTAAAAAACAGTTCATCT
          GCAAGTTCTGCAATCGACAATTCACCAAGTCGTACAATCTGCTCATCCACGAGAGGACACACACGGACGAGCGGCCCTAT
          TCCTGTGATATCTGCGGCAAGGCGTTCCGGCGACAGGATCACCTGAGGGATCACAGGTATATTCACTCCAAGGAGAAACC
          CTTCAAATGCACGGAATGCGGCAAGGGATTCTGCCAATCGAGAACCTTGGCTGTCCACAAGATCCTGCACATGGAGGAAT
          CACCCCACAAGTGCCCCGTCTGCAGTCGATCATTCAATCAGCGCTCCAACCTGAAGACCCATCTGCTCACCCACACGGAT
          CACAAGCCCTACGAGTGCTCTTCATGCGGCAAAGTTTTCCGCCGTAACTGCGATCTACGACGCCATGCCTTGACCCATGC
          AGTGGGTGAGGTCAACTCCGGGGACTATGTGGATGTGGGCGAAGAGGATGAGGCCAGAAATTTAAGTGGCGACGAGGAGG
          ATTCGTTGCTGGAAGTGGACTCGCCTCGCCAGTCGCCAGTTCACAATTTGGGCGAGTCTGGAGGATCGGGTGAGAAATCT
          GAGTCCGAAAGAATGAGACTCAAGCGCAAGGCAGCCATCGATCATGAGGAAAGCGAAGAGGAGTTCGATGACTTCGACGA
          GGAAGAGGAACTGCAGGATCTGCCAAGAGTACACGATTTGCCCAGGGAAGAGGACGACGACTTTGATCCCGAGGACGAGG
          AGCAGGCAGAAGTGGCACTAGTGGCGCGTTTCCAGGCGAGTAAGGCTGCCGCCACATCGCAATCATCGTCGTCAGTGGGC
          ACCAAGCCGGAACGCCAGGGAGTCACCCACTGTCATCATGAGGGTGGTGAAACCTACACAATGCGGCCACATGGCGAGAA
          ACATCAGGAGGAACCCGGGAACTCTGGCATTGCCAGCCTACCCGTTCCACCTTCCTTTGTGCGATATTCTGTACCACCTG
          GGGCAGCTGGACCGCCGCCTGCACCACCTGGAGCTCCTCCGCCAACCCACCAGCACCCAGGACATCCACACTTACTCCCA
          CCCAACGGGGATCCCTATTTGCCCATTCTGCACGTTCGACGCGACTTGCACCACAAGAGCTTGAACCTTTCGAAGGCTGG
          TGTTCCACCGCCACCACATACACCACCCACTATAATAACCCAGCCGGAGTCGGGTAAACCACCCAATCAACCTTTGCATT
          CACCGCATGAAGCTATGCCCAGCTTCCTGGGATCGATACCCATGCGAAAGAGGATTCTTCCGGCACCGACCTTGGACTTG
          ATGGATCCGCACCACCATCCTGGATTGGGTCAAAGGACCTTTGTGGATAGTCCCAGCATATATGCTTTGAATATGTCGCG
          ACATCCCCCCAGACAGCTTCTGGGAAAACCACCGAGTACGGAAACAAGTGGAGCCACCACCGAAAAGGGACCACCAGTGG
          CAGCACCGCCCATAGCACCACCGCCTGCACCACCGAGAAGAACAGGGTTCAGCATTGAGGACATAATGAGGCGTTAGAAG
          TAAACCGAGAAAGAACTAGAAAACAATCCATTAATGGAGGTAAAATCGGAATAGAAAAACAACACAATTTGGAAAACTAT
          TTATCAAAGCTCTTACGAATTTGAAATATCAAAAAGTAGTAGTATTCCTAATAAATATATATCTCGGTTGTTTTTTCTGG
          TATTTCATTTAGAAGGTCTTATGAACAGTTGAATATCATAATGACAAACAGTTATTGTTCCCAATGGTTAAACGAGGATT
          TATCGTTTTAGACCCACAAGTACATTAAAATAAATTTAGATCTACAATTTAATACTTTTTAGTACAATGTCTAGGCAAGG
          CAATAGACCTAAACTAAGTAATAAAATCAGTTAAGCGATAATTGTAAGCGAAACAAACTCCGTTGTTGCATTTTATAGAG
          CTCTTATGCGTTAGGATTTTAGCTTAAATCTACCGATTTAAATGTTTAAGCCTTTAGTACGAGAGTCTATCGATTAGTTT
          TTAATGTGTGGCCCAACACTAAGTGTTGCTGTTTGCTGAGTGAATTCCAATTTTTTATTTATGTTTCCTTATCCGGTAAG
          CTAATCTTAATGAGTAAACAAAATCGTTAATCGATTTTGCTGTAGGGAAAAAAATGGTTGAAAGTAAAAGTTAGTGTAAA
          GCAGAGCATAAACAAAAATCCAACTACAAGCAACATTCCAGTAGAACCTTATGTAATTAGGCTTAAATTTTAAGAGTTTT
          GCAGTAGTTAATATAAGCAACCCATAGAATTCCATGGTCTTCCTTCAATTTTAAATGATTTTATTCAAACCATAGCGAGT
          TAGTTGATTTCAAATAAAGTATGCATTAATAATG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0077493
          3485
          FBtr0077490
          3513
          FBtr0077491
          3424
          FBtr0077492
          3630
          FBtr0307027
          3507
          FBtr0307029
          3435
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0297871
          744
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0077182
          744
          FBpp0077179
          744
          FBpp0077180
          744
          FBpp0077181
          744
          FBpp0297870
          744
          FBpp0297872
          744
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          bowl-RG
          Secondary FlyBase IDs
            References (0)