Open Close
General Information
Symbol
Dmel\Oscillin-RC
Species
D. melanogaster
Annotation Symbol
CG6957-RC
FlyBase ID
FBtr0307060
Feature type
Associated gene
Evidence Rank
Length (nt)
1206
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 154 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          ACGCGAGAGATGCGGTTAAACCGCAAAAACAAACTCAAACTCGAGCTAATCGCTGCATAAATTTGCTGTTCGAATTGAAC
          AATTGAACAGTCTCAGTTAGCAGCTGAAATCGGAAATAAGCGACAAAAGCAGCAGTGCGAGCAAAAATCAAGTAATAATA
          ATCATCAATAAGCAGCTGTTTGCATTCGCGTGTTTTGAAGCTTAACAATGAGATTGGTCATCTTGGAAACCAGCGACTCG
          GTGGGCAAGTGGGCGGCCAAATATGTGATGAAACGCATCAATGACTTTCAGCCGAGTGCCGACAGATACTTCGTTTTGGG
          CCTGCCCACGGGATCTACGCCATTGGGAATGTACAAAGAACTGATCGAGTTTCATAAGCAGGGCAAGGTATCCTTTCAGT
          ATGTGAAAACCTTCAATATGGATGAGTATGTGGGACTGGCCAGAGATCACCATGAGAGCTATCACTACTTCATGTGGAAC
          AACTTCTTCAAGCACATCGACATTGAGCCCAAGAATGTGCACATTTTGGATGGCAATGCAGCTGATCTGGTGGCCGAGTG
          CAATAAGTTCGAGGATCAGATCCGCGAGGCTGGAGGAGTGGAGCTGTTCATCGGTGGCATCGGACCCGATGGCCATATTG
          CCTTCAATGAGCCCGGCTCCTCATTGGTGTCCCGAACGCGGGTGAAAACTCTGGCGCAGGATACACTTGAAGCGAATGCC
          CGTTTCTTTGACAACGATATGAGCAAGGTGCCCAAACAGGCTTTAACCGTGGGCGTTGGCACTGTGATGGACTCCAAGGA
          GGTGATGATCCTCATCACCGGAGCTCACAAGGCATTTGCCCTGTACAAGGCCATCGAGGAGGGTGTGAATCACATGTGGA
          CCGTCAGTGCCTTCCAGCAGCATGCAAATACCCTGATGATCTGCGACGAGGATGCCACTTTGGAGCTGAGAGTTAAGACC
          GTTAAATATTTCAAGGGCATTCTCAGAGATCTAGACGAAGGCTCCCCACTGGAGGGCTACAAAAACTGATAATGCAGTCT
          GATGGACGTCCATTCCAAGCTGATAGAGCAACAAAAGACGACGTAACCCCAGATACTAAAGGGAATAATGGAGATCTGGA
          TTCCATCGTTACCAGCATTATAGTTTTTTCAATCAAAAGGAATCGAATTTTTATACAATAAATGAATTTTTATATGTTAT
          CGCCTT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0079101
          1216
          FBtr0079102
          1529
          FBtr0307061
          1156
          FBtr0307062
          1586
          FBtr0307063
          1388
          FBtr0307064
          1413
          FBtr0331675
          1299
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0297903
          273
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0078734
          273
          FBpp0078735
          273
          FBpp0297904
          272
          FBpp0297905
          266
          FBpp0297906
          273
          FBpp0297907
          272
          FBpp0304065
          273
          Comments
          Transcript terminates at site supported by polyadenylated cDNA.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          Oscillin-RC
          Secondary FlyBase IDs
            References (0)