Open Close
General Information
Symbol
Dmel\lid-RC
Species
D. melanogaster
Annotation Symbol
CG9088-RC
FlyBase ID
FBtr0307069
Feature type
Associated gene
Evidence Rank
Length (nt)
5851
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 56 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GGCAGATCGACGTTTCCGGCACTTCGACGACGGGTCACACTGGACACATGTAGCAGGAAAAAACGCAGACATCGGAGAAA
        GAAATCAGAAAAAACCGAGCGGAATAAATTTAATCTGAACTCATCTTAAAGCTATGTCCGCCAAAACTGAGGCGGACAAC
        ACGACGGCCGCCAACTCCGGCGGCGGAGGAGTCGGGAGCGGCACCTCATCCGGCGGGGGCGCATCCGCGAATGGAACAGC
        AACTCCGGCACGTCGTCTGCGTACCCGAAACTCAACGGGCAACGGGACTAATAGTGGAAGTGAGTCCGTAAAGAAATCCA
        ATGCTAACGACGAGCCCTCGACCCCAGTCACCCCGGCAGGAGCAACAGGATCTCACACCCATGCTCCGCCAGGCATTTCT
        CCGGCGGTAATGGAACGGCCTATGCCCAGTGTTCCCATGAATCACGCCAGCAGCAGTGTGTCAGCCAGCAAAAAGTACCA
        TAATAGTTGTCCTCATCCCACGCCCACGCCTGCGCCCACTGGGCACAAGAAGTCGGTCCACACGCAGCCGCACAGCAGCA
        ACAAGTTTGACCAGGGAAAGAACGAGGAGTTCCACTTTGACACGCCGCCAGAGTGCCCTGTGTTCCGGCCCACAACTGAG
        GAGTTCAAGAATCCACTGGCCTACATCAGCAAGATCCGCTCCATAGCTGAGAAGTGTGGAATCGCAAAGATCCTGCCGCC
        GGCAACCTGGTCGCCGCCGTTTGCAGTGGACGTGGACAAGCTACGCTTTGTGCCACGTGTCCAGCGGCTGAATGAGCTCG
        AGGCAAAGACGCGCGTCAAACTCAACTTCCTTGATCAGATCGCAAAGTTCTGGGAGCTGCAAGGCTCTTCACTAAAGATC
        CCAATGGTGGAGCGAAAGGCTCTCGACTTGTACACACTGCACCGCATCGTTCAGGAGGAGGGGGGCATGGAGCAAACCAC
        AAAGGATCGCAAGTGGGCCAAGGTGGCCAACCGGATGCAGTACCCCTCAAGCAAAAGTGTTGGCGCAACCCTGAAGGCAC
        ACTACGAACGCATCTTGCACCCCTTTGAGGTATACACTTCGGGAAAGGTTCTAGGACCCACACCAACGTCGTCTGGATCT
        GGTAGCACACCCGTCAAATTGGAGGACGGAGGTGGAACCGATTACAAAGCCCATGAAATTCCCACACGGCAGCAGATTGC
        GCCGCCCAACGAGACAAACACACGTCGCTCCAAGCGTTTCGGAAATTCCAATGCCAGCTGCGGCCTGAGTGGTGTTACAC
        CCACAACAAAGCCATCAGCGGGCGTATTTGTCAAGACGGAGACCAAGGAAGAATTTAAGAGGGATCTTCTCAGCAGTTTC
        AATGCTGTCAACAGCGGCGGATCGCCATTAGCCACAGGTACTACGGCAAACACTCGCGGAGCCAGCCAGAAGAAGGGAGG
        AGAGCCTCCAGCACTTATCGTAGACCCACTGATGAAGTACATTTGCCACATCTGCAATCGCGGCGACGTCGAGGAGTCAA
        TGCTGCTTTGCGATGGCTGCGACGACAGCTACCACACCTTTTGCCTGTTGCCGCCTCTGACCAGCATACCCAAAGGCGAA
        TGGCTTTGCCCGCGCTGCGTCGTCGAGGAAGTAAGCAAACCGCAGGAGGCGTTTGGTTTTGAACAGGCAGAGAGGGAATA
        CACTCTGCAACAATTTGGACAAATGGCTGACCAGTTCAAGCAAGAATACTTCCGCAAGCCGGTGCACTTGGTGCCCACTG
        AGATGGTGGAGCGCGAGTTTTGGCGCATCGTGTCATCTATCGATGAAGACGTTACCGTTGAGTATGGGGCGGACTTGCAC
        ACAATGGATCACGGCTCTGGTTTTCCCACTAAGAGCTCGTTATATTTGTTGCCGGGCGACCAAGAGTATGCAGAGTCAAG
        CTGGAACCTTAACAACTTGCCGTTGCTGGAGGATTCCATTCTTGGTCACATCAATGCCGACATTAGCGGCATGAACGCTC
        CGTGGATGTATGTGGGCATGTGCTTCGCAGCCTTCTGCTGGCACAACGAGGACCACTGGAGCTACTCCATCAACTATCTT
        CACTGGGGAGAACCTAAAACCTGGTACGGTGTTCCGGGGTCCTGTGCTGAGCAGTTTGAAGAGACCATGAAGCAGGCAGC
        TCCAGAACTTTTTTCATCACAGCCCGATCTGCTTCACCAGCTGGTGACCATTATGAACCCGAACATTTTGATGAACAATC
        GTGTACCGGTATTCCGAACCGATCAGCATGCAGGCGAGTTTGTGATCACCTTTCCCAGGGCCTATCACGCAGGCTTTAAC
        CAAGGCTATAACTTCGCGGAGGCCGTCAATTTTGCACCTGCCGATTGGCTGAAGATGGGGCGCGAGTGTGTTAACCACTA
        TTCCATGCTGCGACGTTTCTGTGTCTTTTCGCACGACGAGCTCGTTTGCAAGATGGCCCTGGAGCCAGCGAAACTCACAT
        TTGGCATCGCTACTGCCTGCTACATCGACATGGCCGAAATGGTCGACACGGAGAAGAAACTGCGCAAATCGCTTTTGGAG
        TGGGGCGTTACCCGCGCAGAGCGTCGCGCCTTCGAGCTAGTAAACGACGATGAGCGCCATTGCCAAGAGTGCAACACCAC
        GTGCTTCCTGTCGGCGGTGGCCTGCGAGTGCAACGACAAGTTGATTGTCTGTTTGCGCCACTATACGGTACTCTGCGGCT
        GTGCTCCTGAGAAGCACACTCTGATATATCGTTATACACTGGACGAGATGCCGCTGATGCTGCAGAAACTTAAGGTGAAG
        GCGCACAGCTTCGAGCGATGGCTTTCACGTTGCCGTGACATAGTCGATGCACATACACCCACCTCGGTGACCCTGCAGGA
        GCTGCAGGAATTGTGCAAGGAGGCCGAGACGAAAAAGTTTCCCTCCTCGCTGCTCATCGATCGCCTTAATGCTGCGGCCG
        TTGAGGCAGAGAAATGTGTCACAGTCATACAGCAACTGGGTATCAATAAGGTGCGAACTCGCTCGGACCACAACCAGGAG
        GCTGCTCAGTACAAGCTAACCATGGAGGAGCTAGAGTTGTTCGTTCAAGAAATCGATAATCTCTGCTGCATCATTGACGA
        GGGCGCTTCGGTGCGAGAGCTGCTTGTTTTGGGAAAACAGTTTGTGGAGCGGTCCGAGAGCCAGCTGCAATTATCGCTGG
        AGTCTCTGGAGGAGAGTGAGCTGGAAACGTTAATAAACGAAGGCAGCTCCTTACGCATCGAACTGCAACAGCTCGACCTA
        CTGCAAAAGCGACTGAAGCAGTGCAAGTGGTACAAGCGCTCGCAGGGATTGAGGGAGACCAGCTCGAAGCTGACCTACCA
        AGACGTGAAGAACCTGTTACACATTGCGGCTGCTGACCTTGATCCCACGGATCCGTATGTCGACAAGGAGATGCGAAAAT
        TGCAACAGATCGGTGCAGATATCGAAGCCTGGGAGTCGCAGGCGGCCAAGTATTTCCGGCGACTGACCCAACAGCACGAA
        CTGGGCGAAATTGAGCAGTTCTTGAAATCGGCCTCCGACATCAACGGTCAAGTGCCTTCGCATGGACTGCTGAAGGATGC
        ACTACGAAAGGCGCGTGAGTGGCTACGGGCCGTTGAGCAGCTACAGCAAAACAACCACGTCACATATTGCCACACACTGG
        AGGCAATGATCGAGCGCGGCTTGAACATACCCATCCAGCTGGAGGAGCTGAGCCGAATGCAGGGACACCTAAATAGTGCA
        CATCAATGGAAGGACAATACAGCGTGCGCCTTCCTCAAGAAGGGCACCTTCTATACGCTCTTGGAGGTTCTCATGCCCCG
        GTCGGACGCCATCAACATAGACTCGGATCTCAAGCCGCGCTTCCAGGATGATTTTCTGAAAGAGAAAAATCCGGCGGAGA
        TTGTGGCCAGCTTCAAGCACGCTGAGGAGCAGGAGCTGCTCGATATGCGCGAACTTCGGCGGCAAAATATGAACAAGAAT
        CCCATGCGCGATATGTTCTGCTTGTGCAAGTCCGAGTTCCGAAACTTAATGTTCAATTGTCAGTTGTGCCGCGATTGGTT
        TCACGAGGATTGCGTCCCACCGCCATCAGCCACAAATCAAAATGGAATTGTTAACGGCGGATCAGGACCAGGTACCAATC
        GACCCAAGTGGCTATGTCCGAGCTGTGTGCGCTCGAAGAGACCGCGCCTAGAAACCATCCTTCCGCTACTTGTCCAGCTG
        CAGCAACTGCCCATCCGTCTGCCCGAGGACGAAGCGTTGCGTTGCCTGGCGGAGCGTGCGATGAACTGGCAGGATCGGGC
        CAGGAAAGCTCTTAGCAGTCCTGACGTCAGTGCGGCTCAAGAAGCGATTATGGCGCAGCAGCAGCAGAAGCGGCGCTCCG
        AGGGTGGAGCAGGGGTGGGAAATATCAGCAGTCCACGGAAGCCACGTCGACGGGGGAGCCTGACGAAAGAGGCAAGTGGT
        TCAACAGAGTCCGATGCCGACGACGATGACGACGAGGACGAATGTCGTCTTCGAATCGTCGAAGACAACTTTAGTAACGA
        TGAAGATGAGCCTCGTACCGCCCCCGCGACCTCCACCGTCAACTCCGATCTCCTCAAGCTGCTGTCCGACAGTGAAATTG
        AAAATTTGCTTGACCTGATGATGGAGGGCGACCTGCTAGAGGTATCCTTAGATGAAACGCAGGAGCTGTGGCGCATTCTA
        GAAACGATGCCGCCCACGTTGCTGCAGGCGGAGGCCATGGAGCGTGTTGTCCAGTACATGCAGCGTCAGCGGCAACAGCA
        TACAAATCCGCTGCCAACATCCGGCGCCGAAGACTCTAACGATAGTCTGATGGTACAAAATAGTCCCAATAGCAACAGCA
        ATAGTGGCGGGGCAACGGGTTCTGCGAGCAACAGCGGACGCAACAAGAAGAGGCGCTCCAACGACACCGGCGGCAACTCG
        GCAGTGCCGCGCAAGAAGCAGAGCACACCGAAGCAGACACCGGGCAAGAAGGGATCAGCGGCAGCGGCACGCAAGAGCGA
        TGCCAAGGCATCGCCAGCAGCATCCACCACTCCGGGTGCGGATGCCGATGCCGAGAATAAGCAGGCCAACGGCGGTAATA
        CGAACTCCAGTACAGGATCAGGTGGTGGCAATTCTGCGACGACGACGCCCACACCCGGCTCGACGCACAAAAAGCGAAAG
        CGCACCTCAACCACAGCCACCAATAATAACAACAACAATAATAATAACAGCACGAACAATAGCAACAGCAGTACCAATTT
        GAACAGCAACACCACCAGCGGCCAGGGAGCAGCTACTGGAGGCAATAATGCGACTGGCGGTCAGAAGAAGCACGCGCAAC
        GGTCTCAACAGGCGGCGCAGGAGGACGACGAGGAGGAGTGCCGGGCGGAGAACTGCCACAAGCCAACCGGGCGAGAGGTG
        GACTGGGTGCAGTGCGACGGCGGCTGCAACGAATGGTTCCACATGTACTGTGTGGGCCTCAATCGCAGCCAGATAAAGCC
        CGACGACGACTATATCTGCATTCGATGCACAAAGACAGTTGCCATCGGAACACAGGGCTCCGGTCACAGTATGAGCGTGG
        CGTCCACGACGACGCCGGGCAAGCAGCGGGCGGTGCAATCGGCGCGGTAGAGTAACGTATATAGAGTCCAGGAGGTGCAG
        TAACAGCCGATTGTGTTTTACGCATGATGTACTACTAAATACCCGATAAAGGCCGTCTACCGGTATTTACTAAGTTTAGT
        AAAGTCACTTGAGAGTTTTTGTAGTACATATTTACCAATTATCGCTATATTTACGCATTAACAACGTAAAACACATTTGA
        AAGAAAACGTC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0079231
        5963
        FBtr0079232
        5831
        FBtr0307070
        5841
        FBtr0307071
        6941
        FBtr0345336
        7004
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0297912
        1838
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0078862
        1838
        FBpp0078863
        1838
        FBpp0297913
        1838
        FBpp0297914
        1838
        FBpp0311492
        1838
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        lid-RC
        Secondary FlyBase IDs
          References (0)