Open Close
General Information
Symbol
Dmel\salr-RC
Species
D. melanogaster
Annotation Symbol
CG4881-RC
FlyBase ID
FBtr0307093
Feature type
Associated gene
Evidence Rank
Length (nt)
5189
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 11 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TAGAGCGCCGTCGACGCTCCGGCTCGCAGGACGTCGCTGCCTCTGTCGCCGCCATTTGCCGCCATTTGCTCTCTTCGACC
        GCGCGGGGGCGCCACTCGCCATAGAAGCAGCAGCAGCAGCACCACCGCCAGCAGCAGCAGCAGCAGTCGCCAAAAAGGAC
        ATTCGCTTGCTCCACCACACCACTCGGCTTTCGAGTTTGTCGCTTCTCGGTTTCGGACTCGTTTCGCTTCCAGCCCCGAG
        ATTCCGATTCGATTCCCGATTCCGATTTCGATTCATCAGTTCATAGTTTCAGTCGGCGAGCCAAAAAGCAGCCTGCCAGT
        CGAGAGCGCCTTTCCCAGAACTCGCAGCCTGAGCCTGAGAGTCCAGGAATCCCACAAAGATTTGCCAGTCTTTGCCACTT
        AAAGTCTAACGGTATCGCAGTGCGTTTTTATTACCGCCGCCCCCGCAACATAAATACACACAATTATACGTATGTGTATT
        TGGGCACACGGACACGCAGAGTTGTGTGTGCGGGGGGCGGGGGCATGCGTGCGAGTGTGTGTGTGTGGGCTGAGCGGTCG
        CGCGTGTTTAATTAATCATAAAATCTACGTCGGAAACCGCGAAACTAAAAAGTAACTCGCAAAAAACCCAAAAAACAACA
        ACCAAGCCAAAAATTAAAAACAAACAAATAATAATAAAAGAGAAAGAGAAGGAACGTGTGTGGGAGGGGGACGGCGAGAG
        GGGGGCCAATGTGCAATAAACTCGATTTTGGAATAAACTCAATCCTGTGCAAAAACTAACGATCCGCATTGCCGACGGCA
        TCTGTGAGACAATTTACGCAACCAAAAAGATGCTAACAAAAGGATAGCGAAAATCAAAAGGAAAAGGAGCAAGAAGCGAC
        GAGTATCAAGGTGCAGTCCATGTTCAGACTCCAGCGGCAATTGGGATCAGGAGGTGAGCGCTTCCGATCGAGAGGATAAT
        GTGTTCAATATTTCGCAACCGCATCAATTACCGTGGAACTGGTGGCACCAGGAGCGGCAGCGGGGAGCGGGAGAGGGACC
        GAGATCGGGACAGGGATCGTGATCGAGATCGGGAAAGGGACAGAGACACCCTGCTGGCCAAGGAACTGGATGCGGATAGC
        AATAACAATGGTACCGAGCCACAAATGGAGGCGGAAGCAGTGCCGGAATCTGATACGGAAAGAGAAACGGCCGAGGAGCG
        CGGCGAGGAACAGGAGCCGGAGAACAGTAACGAGGCCCTGGATCTCTCACTGATTTCGTCCGGCGGTCGGGAATCACTGC
        CGGGCAGTGGTCACGTGTCGCTGGAGGCTCTACAACATACCAAAGTGGCGGTGGCCCAGTTTGCGGCCACTGCGATGGCG
        GGAAACCACCAGTCCGCCGATCTGGCCATGGTGCAGTCCACCATCTTTAATGTGCAGCGGCAGCATCTGATGCAGTTACA
        GCTCATCCAACACCTGCAGAGTCAATTGAAAAGGGCCGAGGCAGCCGCCTTGGGTAGGCACTCTCACAGCGATGAGGAGG
        AGGAAGAGCCGGAGCCAGAGCCGGAACCTAAGAAGCAGCCCACCAATGGCCTGAAGGAGGAGTTGGAGCTGGAGCAGGGT
        CCGGAGTCAGAGCAGGATCAGGAGTCGCGGCGGGAGGAGAATTCAAAGACTGACAAGAGGGGAACTGAGGACAGAAAGGC
        AGAGCCAGAGGGTTACCAATCGATGATGTGCGACATAAGCTCGAGTCTGGCATCGAGCATTATCACCAACCACGATCCCC
        CGCCAGCCCCCAACGAGCCCAATTGCCTGGAGATGTTGCAACGGAGAACGGAGGAGGTCCTCGACTCCGCATCCCAGAGC
        TTACACGCTGCTCAGATGCAAGAGGAATACTCGGAGTATGCCTCCAAAGAGGCTCAAAGTCGCGGTGAGATCTTTAAGCA
        TCGATGCAAGTACTGTGGCAAGATCTTTGGCAGCTACTCGGCCCTGCAGATACATCTGAGATCACATACCGGTGAACGCC
        CATTCGTTTGTAATGTTTGCGGAAGTAAATTCACCACGAAAGGCAATCTGAAGGTTCACTACCAGCGGCATACGCAAATC
        TTTCCGCCAATGCTTCTGCCACCAGGAGTGGCGCCCAACGTGGGTCATTCGGGTCAGGGGCAAGTCCAGGGCGAGCAGTA
        TCCCATTCGCCTGCCTTTTGCGCCACCAGTAGCACCTGTGGGTCAGGAACAGCATCAGAATCAAGTTGAGGAGCCGGAGG
        AGATTAGACAGGAGATTCCAGTTCCGCAGGCAGAAGATCTCAGCAAGCCAATGGTTAAGGAAAAGGAGAAATCCCACTCG
        CCCGTGGAGCGTGTCAAGACTCCCAAAGAAGTTAAGACAGATGCAGCGCTGCCGTCATCAGAGAAGCCTGAAAAAGAGAT
        CTCCAAGCCGGTGGTGACCTCGTCACGACGAAATGGATCTGTGCGGAAGCGACAAACAAGTGCTGTTAGCCCGCCGCAAG
        AGGATAGGGAACGGGATCTTGTCGAGCACTTGCACATAGCCAAGCTGGTGAGACGCTCCTCTGCCAGCAGAGAATCACAG
        CCGGCGGAGTACTCGCTCGCGCAAATGGAGCGCATTATCGACAAGTCATGGGAGGATCTGATTGAGATCGACAAGACTTC
        GGAGACCTCGAAGCTGCAACAGTTGGTGGACAACATCGAGAACAAGCTGACCGATCCTAACCAGTGCATCTTCTGCCAGA
        AGGTTATGTCCTGTCGCAGTTCCCTGCAAATGCATATTCGCACCCATACCGGAGAGCGTCCGTTCCGTTGCAAGATCTGC
        GGCAGGGCTTTCGCCACGAAGGGCAATCTTAAAGCCCACATGAGCATACACAAGATCAAGCCGCCGATGAGGAGTCAGTT
        CAAGTGTCCGGTGTGCCATCAGAAGTTCTCCAACGGCATCATCCTGCAGCAGCACATTCGCATCCACACCATGGACGATG
        GCAGCGGTGGTCAGGGAGCCCCTGCCGCCAATCCTGGCGAGGCCGAACGGCTGGGTATCGAAGATCAAAACTCGAACAAG
        TCCCTGGGCACTTCGGATACATTGGATTTCTCCACCACCATATCGGATCACTCGGGTCAAAGATCTGAGTCCTCGCAAGG
        CGGAGATTTTGATGAGTTTATGACCATGGACAGCACGGATGACTCCAGGGATAACTCAAGTGCGGCCACAGCTACGCCTC
        ATCCTCTAGAAAGAGAGAGGGATAGGGAGAAGGAGCGGGAGAGAAGGATTCCCAACGATTGCTCTGATGAGAGATCGCAT
        TCCAATCCTGATTTAACTGGAGGCCGCAGCGAGAGTGGCGAAATGCCCGCCATGGATCTCTCTTCACCCTCTTCCAACTC
        GGGTCGTATCTTCGCAACTGGACTGGCTAACGGAGCTGCTGGTGGAGGATCTGGAAATGGTGGTCTTCCCATGCTCGGAA
        TGCCCATGCCTCCAAATCTTCTGCTCATGGCAGCTGCTCGCGAAGAAATGCACGCTCTAGGTCATGCTCACGCCAAATTT
        CCCCTGCTGCCCTTTGGTCCACTTGGATTTATGGGTCTGCATCCGCCCCCAAATGTGTGCAATCTCTGCTTTAAGATGCT
        GCCCAGTTTGGCCGCCTTGGAGAGTCATTTGCAGAGCGAACATGCCAAAGAACCGGCGACGGGCCACGCCCAACGCCCAC
        AGTGCAGCGATGCTGGATCGCCGTATGGAGCAAAGCTCACTCTCAATCCAAATCTGTTCGCAAAGAAGCCGCCTTCGTCG
        TCGTCCTCGTCGTCGGGTGAAAAGTTGCCGGAGTCATCCAATCCGCCCTTTCCCGCTGAAAATCCCCCAGCAACGCCCAT
        CAAAGAGGATCCCGATCAGGAGCAGTTGATGGTGGAGGAGGGTGCTTCGGCTGGAGAAGGATCTGGCACCGGAGCCACCT
        CGAATTATCCCCAGGAGGCCGGCGATGCCGAGCAGTCACTGATGAAGATGCAGCTCCATGCCCATCGTTTTCCTGCCAGT
        CCCCTCGACTTTCAGCAGGCTCTGATGTCCGCAGGACCACCGACTTCTAGTTTGGATCCGCCGGTGAATAACAAGCACTT
        TTGCCACGTCTGCCGGAGGAACTTCAGTTCGAGTTCCGCTCTCCAGATCCACATGCGCACCCACACGGGCGACAAGCCCT
        TCCAGTGCAATGTGTGCCAGAAGGCTTTCACCACCAAGGGGAATCTCAAGGTCCATATGGGTACTCACATGTGGACGAAT
        CCGACTTCGCGGCGGGGTCGTCGAATGTCCTTGGAGCTACCCATGCGACCTGGTCCAAACTCCGGCCAAGGTCATCCTGG
        ATCCAGTGCAGAGCAGGAGTTCATGCAGAGACGACCAGAGCTCTTTTTTCCCTACCTGCCGCCCTTCTTTAACGGATTGC
        CACCAAAGCCTGGGGAACTCAGTCCCGGCGCCTTTCCCAATATTCCCCCGCCTCCCTTCGCCAACGGCGGGAAGTATCCC
        TATCCGCCCGGGCTCCTTGGCTTCCCTGGTTTCCTGGCCCAACATCCTTACATCCTAGAGCGGAGGAGCAGCAGCAAGTC
        ACCCACGCCAGAGCCGGCTCAGAGTCCCGCCTTGCGGGAGGAGGAGGGGTCCGGCAATATCTGGCATCCACTGAGTCGCA
        TCAAGGTGGAGAACAATCAAAACGAGTCCATGGGTGGCTTTAACGAGCAGGAGGATCACGCTGAGACGGATGCCACTGGA
        GGGGACAACGACGAATCGGAGTCCAGGGATGCGGAGAAGTAACGTGGATGAGGAGAAGCTGATGAGATCTTAGTCTTGGA
        ACACACATGGTTTTTGTGGAGTACATATCTTGAGCATTACCCTACGCTAAGCTTCTACTAGCACTGACACAAACTCAAAC
        ACAACCACCCACACACTTATACGAATATATCCTTTGTGTCTATACAAATATATATATACATAGTACGGTTAATTGATAGC
        GATCTTCAAGGCATTTAAATGCATTAAGTTTAGCCGGTAAGTTGTAAAAATAGCGGATTGAGGAACGAACTTGACTGGAG
        AAATATCTTCAACCGGATCAGGCAGGCTGCGAGGTCGGAACTTAACTAATTTTATGGCTATACTTAGATATATTTAACTA
        CATATACCGATAAATACACGTAATGTAAACTGTGGTAGTTGCATATAAAAAAATTGAAATCGAAGCCCG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0080235
        4142
        FBtr0080236
        4408
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0297936
        1267
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0079822
        1267
        FBpp0079823
        1267
        Comments

        Extended 3' UTR based on RNA-Seq and/or EST data.

        Transcriptional initiation is supported by short-capped RNA data (FBrf0209722).

        5' exon based on stranded RNA-Seq data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        salr-RC
        Secondary FlyBase IDs
          References (0)