Open Close
General Information
Symbol
Dmel\Parg-RC
Species
D. melanogaster
Annotation Symbol
CG2864-RC
FlyBase ID
FBtr0307280
Feature type
Associated gene
Evidence Rank
Length (nt)
2599
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 47 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ATGCAAGAATTCAGGTCACACTTGATTTTTCCGATATTCCAAAAGGTTTACCAATCTACGGCAAATCGCCGCAGAGCAAG
      TGCATCCGTGCTGACCAATCGACTCGGCAAGGCTTTGTGCTTAAACTGCGCCAGGATGTCGAAGTCGCCGGATGGCGGGA
      TTTCCGAAATAGAAACGGAGGAGGAGCCGGAAAATCTGGCGAACTCCCTAGATGATTCGTGGCGTGGAGTTTCCATGGAG
      GCTATACATCGTAATCGGCAGCCTTTCGAATTGGAGAATTTGCCACCAGTGACTGCCGGCAATCTCCACCGGGTTATGTA
      CCAGCTGCCAATTCGTGAAACACCGCCACGCCCCTACAAATCACCGGGAAAGTGGGACTCCGAGCATGTGCGTCTGCCCT
      GTGCGCCCGAGTCGAAATATCCGAGGGAGAATCCGGATGGCAGCACCACCATCGATTTTCGCTGGGAAATGATCGAACGA
      GCCCTTCTGCAGCCCATAAAGACGTGTGAGGAACTGCAGGCGGCGATAATATCATATAATACCACCTATAGGGATCAGTG
      GCACTTTCGTGCCCTTCATCAACTTCTCGACGAGGAACTGGACGAGAGCGAAACACGGGTTTTCTTCGAGGATCTATTGC
      CGCGCATTATCCGATTGGCATTGCGGCTACCGGACTTGATTCAATCGCCAGTTCCGCTGCTCAAGCACCACAAGAACGCC
      TCATTGAGCCTGAGCCAACAGCAGATCTCCTGCCTGTTGGCCAATGCCTTCCTGTGCACCTTTCCCCGGAGAAACACCCT
      CAAGAGGAAGTCCGAGTACAGCACTTTTCCAGACATCAACTTTAACAGGCTTTACCAATCGACGGGACCGGCAGTTCTGG
      AGAAGCTTAAATGCATTATGCACTATTTTCGTCGCGTGTGTCCCACAGAGCGGGATGCCAGCAATGTGCCCACCGGTGTG
      GTAACCTTTGTTCGTCGGAGCGGATTGCCGGAACATCTGATCGACTGGAGCCAAAGTGCGGCGCCGTTGGGTGATGTGCC
      ATTGCACGTGGATGCCGAGGGAACAATCGAGGATGAGGGCATTGGACTGCTGCAAGTAGACTTTGCCAACAAATATTTGG
      GTGGCGGTGTCTTGGGACATGGCTGCGTTCAGGAGGAGATACGCTTTGTTATCTGTCCGGAGCTATTGGTGGGTAAACTC
      TTTACGGAGTGTCTGCGACCATTCGAGGCCCTGGTGATGTTGGGCGCCGAAAGGTATAGTAACTATACGGGATATGCCGG
      AAGCTTCGAGTGGTCCGGCAACTTTGAGGATTCAACGCCAAGAGATAGCTCAGGTCGTCGACAAACGGCCATTGTGGCAA
      TCGATGCCCTACATTTTGCCCAGTCACATCATCAATATCGCGAGGATCTCATGGAAAGGGAGCTGAACAAGGCGTACATT
      GGATTTGTTCACTGGATGGTGACGCCGCCACCGGGTGTGGCAACTGGTAACTGGGGTTGCGGCGCATTCGGCGGTGACTC
      CTATCTGAAAGCCCTGCTGCAACTTATGGTCTGCGCCCAGTTGGGCAGACCTTTGGCCTACTATACCTTTGGAAATGTGG
      AGTTTAGGGATGATTTTCATGAAATGTGGCTGTTGTTTCGAAATGACGGGACTACGGTGCAGCAGCTTTGGAGTATTTTA
      AGGTCGTACAGTAGGCTTATTAAGGAGAAGAGCTCCAAGGAGCCGCGTGAGAATAAGGCATCCAAAAAGAAGCTATATGA
      TTTTATTAAAGAGGAACTTAAGAAGGTCAGAGATGTGCCCGGAGAGGGAGCATCCGCCGAAGCTGGAAGCTCTAGAGTAG
      CTGGATTAGGCGAAGGAAAATCAGAAACATCAGCGAAATCCTCGCCAGAACTCAACAAGCAACCCGCCCGACCGCAAATC
      ACCATAACGCAACAAAGTACCGATCTATTGCCCGCGCAATTATCGCAAGATAACTCAAATTCTTCGGAAGATCAGGCCCT
      TCTTATGCTGTCGGACGATGAGGAGGCCAATGCCATGATGGAGGCCGCTAGTCTGGAGGCTAAAAGCAGCGTAGAAATAA
      GCAACAGCAGCACAACGTCCAAAACGAGCAGTACAGCCACGAAATCAATGGGTTCAGGTGGCCGCCAGTTGAGCCTGCTC
      GAGATGCTGGACACCCATTATGAAAAGGGTTCGGCCTCGAAGAGGCCACGAAAATCACCCAACTGCAGCAAGGCTGAGGG
      TTCAGCAAAGAGTCGTAAGGAGATCGATGTGACCGACAAGGACGAAAAGGACGATATTGTTGACTAGGTGATATTGCACT
      ACAGGATTGTTACTGCCCCCAAAATTGAAGAGGTATAAAATGTATTGTAGATAACTTTAAGGACATATTTAGGGCATTTT
      AAAGTAGGATCATTGTAAGTCGAATAAAGTGAAATTTTTTTTTTTTTTTTAATTATACTATTCTAATCTGCAAAGACAAT
      TTTACTGTTAAATTTGTATAACATTGATTGATTAATATAATTTGTTATATCATGCAAATCTAGCTTTTATTATGCGAAAT
      TTGTAGTTAAAGCCAGTAAAGTTTCTTTTTATTTAACCG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0307279
      2521
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0298281
      723
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0298280
      723
      Comments
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      Parg-RC
      Secondary FlyBase IDs
        References (0)