Open Close
General Information
Symbol
Dmel\CG2841-RD
Species
D. melanogaster
Annotation Symbol
CG2841-RD
FlyBase ID
FBtr0307284
Feature type
Associated gene
Evidence Rank
Length (nt)
4955
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 43 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      TTTCAAGCCGAACGGACGCTCTCGCTGCGCCGATTTCTCGCTGCGGTAGAAAAGTGGGAAAAGAATTCGTCGAGCTTTGT
      TTATTTACATACGTTACATGGCTTTTTAATTGGCTGTGCGAGTATACGAATTTTCGAGTGTGTGCAAAATAATTTGCCTT
      ATTTTGTTCGCTTCTTTTTTTTTTGGAATTTTTTTTGTTTTTTTCTCGAAAGTGCCTTCCGAAAAAAGTAACCAAAAAAA
      GAAAGATAGAAAAGAGAGTGTGTGAGAGAGTGCTAACCTGGGTACAGGCATTATAGACCGATGCATGTGAACTGGCAGGA
      AATAGAGCGCCATTAAGCCAACAACAGCACACCACATATCACATCACATCACATCACTCCACATCAAAAGGCAGTTAGAA
      CCATGGAAAGACGCGGCCCAAACAGATTTGCTAATTGAGGTCGTTGTCTAGATTTTGCAGCGCACAAATCGCACGCCATT
      TTTTTTTTTTAGCATGCTCTACGCATATTACGAAATTCGATCGAAATTTTAAAGCAAACGGCGAGTTTAAGAAATTAGGA
      CACCTTTAGACAGGAAACCAAAAGCGGAAGTCGGTGAAGGAGGAAGAAGAGGATAACGAGTGAGAGTGAGAGAGAGAGAG
      ACACTAACGAAGCCACGCCCACGACATGAGCAGCATGAAGGGCAGCTTCGCCACACTGAACCGCTGGTTTGGCCGAAAAA
      AGGACAAATCCGGCACTGGCAACTCCTCCATGGGCAAGTTGTCCAAGTCGTCGACACAGCTCCACCATTTGTCCACGGAC
      ACGGACATCAACGAGACTAGTCAATTGGAGTACAACCGGATAACCCCGGTGCCCGCGGCAACCAGCAATGCGCCCTTTGA
      ACAGACCTTCCGCATCACCGTTCTGCTGCCGAAGGATCAGCTCTTCGTGGCCCGATTGGGAGCCAGAGTTCCACTGAGTA
      AGCTCTTGTCCCTCGTCTGCGACAACAAGCAACTGGATGCGGACAAGTACGAGTTTCGCAGTCCAGTGGATGCTAGTCAG
      GTGTACAGCTGCGAATCAACGATCGGAACAGTGGGTCTCTCAGAGATCCGACTGTGCCACAAGTCGGAGTCCTATGACAA
      CTTCAATCCGGACGTAATGCACAAATTCCAGCGCACCGGTGTCGCTCGAGACTCGTTGAGCAGCAGCTCGGACTTCAGTA
      GCAGCCGGCACTCAAAGGTCACGGCCAAAACGCCGAGTCCGTACAGTTCCAGCAACTCACTGAACTCCATGGACTCCACG
      GGAATGAACTACACTCGTACCCCGGTGGTGGTGCCACCAGCAAAGGTACTAGCACCGCCACCCCGCAAAAAGCGAACCGC
      TCCTCGGCCGCCAAGCCAGGTTTGCATTCCAGAGCAGTCTGTTCCGGATATTCCAGCTGCTAACTCGAAAAGCGAACCCG
      CTTATGCGGTAATTGTCAAGCGCCCCCAGCTCTGCATGTCCACGCCCAACCTCTCCGGTCCCTTGGAGTTGGACTGCAAT
      GGTAACGGCTCAAAGTCGCCGGATGAAGACTCAACGGATGGCCATTATGCTACACTGGATCTGAAACCTCCGATTGCTGG
      CGGTCCGGAGCCAACGCCTCGAAAGCGATTGCTGCAGATCAAAAAGAAAACGGCACCGGCTCCACCGCCGGACTTTCAAA
      GTGGGGGAGACAATATATCACTGGCCTCACTACCGGAACCGGTCACACCTACCCCGAATATTCCGCAACCAGCGCCTAGG
      ATAACCACTCCCTTGCCCATTGCCCCGACAGCCAATCCTCCACTTGCCCAAGTAAATGGCAATGGCAACGGATCACCGAA
      TGGAAACGTGTCCAAAGTCCTTCTGAATAGAACGCCCACTCCGGAGCCCCGATCCCTGGGCAGTGCCACAGAGGATGATG
      ACAACGATACGGCATCAAAGCAAGCGGATTCGGGAATCGGAGAGCCAGCGCCATCGCCATCCGTCTCTCCCGAACCAGAG
      GCGGAGAAATCGCAGCAGGAATCGAGTTCCGAGGACGATGAGGCAATCAAGGTGTACAATTTCAAGCTGTGCCAGACATC
      CAAGAAACCTGAACCATCGGCAGCCACTTTGGCGGAATTGACAGCTCTGACAGCGCAGGATATCGAGGAGGAGGACAATC
      ACGTGGATCAGCCAGCGAGCATAACAAATGGAAATCTGGCCACTCCCAGTAGCGAAACATCGCTCACGTCGTGGAACTAC
      TTGGATCCCATCTCTCCCCCTCCCGACTTCTCCGATCAGCAAATGCAGAAACGCAATGCTGGTTCGTTAAGTCCTGGCTC
      GCCGCTAGACGAGATCGTGGATGAACTGGCCACTATAATCAACCAACAGCGTCTGGATACGTTGATAAAGAAACAACCCG
      ATCCCCAAATGGTTGAAATCGAATCGGCCAAACCAAATCGATTGGCTAACTTCAGCATAACTACGGCGAAAAGTACGACG
      AGGATTGGACGAGCTGACTCCTTTCAGGCAGGCGCCTCAGGCGGAGGGACAGAGGTAGCCTCATCCGGAAGAGCTCTAAG
      TCATCGCAGCTCTTCTCACGTCTCCCTAAACAAGCTGGAGCAGAATGGCATTGGTTTGGGTCAGAGACGCTCGTCTAGTG
      AGTTGAGCATTGGTGAATCACCATCATTGCAAAGTCCAGAGGTTATCAAGACCATTCTGAACTCTAGAAAGAACAGTCTG
      GCCGAAAGTGGAGGCAGTGCATCTACTCCTGTTACAGAGCAACCAAAGATCATTAAGCAGCTGGAGAGCCTGGCCAAAGA
      ACAATCATCAGTGGATGGAGTAAAAGACATCAGTTCCTCTCGTTCTGAAGCTTCGCAACAGTCACCTACGCCTGTCCCGA
      AAAAGTCGAATCCTGGAGTTGAGAAACCTACATCTCCGACTTTCAGAGCTGTGCAGGAACCTTATCCGTCTTCTCCTGCA
      CTGCAGAAGTCATCTCCTGCCGTACAAGAGCAGAGAACTTCTCCAGTTGAAAGGCCATCGTTACCTCCAGCTGTGAAATC
      TGTCGAGGAGCAAGCTGTTTCGTTGCATCAAAAGGAGATAGTTGTACAGAAAGAATCGCCGCCACTTGAGTCCATGAAGG
      AGTCATTTGTTATTGTGTCAAAGATGTCTCCGCCAGCTGTCAAGAAGGTCCCAGATCCATTCCCAAAAGTTGAAGCAGTC
      AAGGAGGAATCATCAGGCAATGAGAGCTCCCAATCCACGATAACTCCTCCAAATACCCCAGCCACTCCAGTCAGTCCGGT
      TAATTTACGAAACCCCAATAACACAATGGCGGAAATTGAACAAAGCCAGCGGGATGAACCAGCTCCGAGCTCCAAGCCTC
      TGCCAACCACATATCGGTATTCCGGACCACCGAGCATTAATTTCGCCACCTGGAGCGAGCGACCCAAATCCACTGTGGCC
      ATTAAGAACGAAGGCGACTATATCTTTGGCGGGGCAGGGAAGTCGCAACAGTTGACTTCACCGCCTTCCAAGCTCACCAT
      CGGAGTGGCTTCACCCATTTTGAGGATGGGTATTCCGCAGGGAAAGGAGTATCATGTTCCCATTACGGTTAAGCCACTAA
      AGGATGAGATTTTGGAAAATCAACAGCAGGAAAAGAAGGAGAAGCCGGAGGTCCAGGAGCTAAAGGATCAAGAAATCGAA
      AAGGAAAGTGTTTCAGTTAAAGTAAAGCCTAAAACGCCGGTGAAGCCGGTACAAAAACGTATAGAAAAACCACTGGATCA
      GGACCAAAACTCCCTTCAAAACCATTCCTCTACATTGCCGCGTCCAGCCAAAAGCAATCGATTCACTCTACCCGCTGCCC
      AAAACAACCAAATGGTCTCCCACTTGACCATGAACTCCCTTCCACGCCCTGTTTCCAGTTTGGAGAGGAACAGACCAGTG
      GAAGCCAATCCTGCACCAGCGCCCTTTGGCCAGAGTACTCTACGCCGCACAGGCTTCAAGGAACGTATGTTGGCCAAGGA
      GCAGCAGGAACAGGAGCAGGCCTTGAGAATAAGGGTGTCCGTGAACGAAAGCATTCCTTCTTCAGCTACCGCGCCCAAGT
      CCCCGCCAGAAAGCAAACCAGCACCGCCGTCAATAAGTGGCTACGTCGCTCTGAAGTCCACCAAAGTGGAGGTAAAGCTC
      CAGGAGCCAGAAACTAAGCCGGTGAGCCTGCAGGTCAAACTCAAGCCCACTGTCCAGCCAGCGACCACACCCTCCCCTCC
      GCCGCCGCCTCCGGCACTGCAGCCCGTGAAAACCAACGGCGGACGCAGTGGTCCCACCGCGCCTGATCCGCGCTCCCAAC
      TGTTGGACGCGATACGGAACTTCAAACGCGAGGACCTCAACCGATCCTAAGTTTTTGAAAGTGAACTGAGGAGAGTCGGG
      CAAAAATTATTGAAGCAGCGCACAAGTTATATATTTTTTAAACCGTTAACAATACATTTTGTGTTGAGTTTGTATATAAT
      TTCGATAAAGCCAAGATTTAGTAAAACTTATTTTCACCTCATCCCCGTGCTTTTAAAGTGCCCCCCCCCCCCACATTTTT
      TTAACTAATCTTAGTTTTTGTTATGAACTATGTAGTTTTTTAAAAGTTTGTTTTAGTCATTAGGTCACAAGAGAACCCAA
      AAAATTAACAAGAAAACGAAAAGCGCAAAATTTATCTATATAAATATATATCTATATATATATATGTATGTTATTATGCC
      GATATAATATTTCTTACGTCATAGTGAAATATAGTAACCAATTTTCTAACCAATGGGACTGGTCTACTTAGTCGTGTCAA
      ATAAATAAAAGCAAACGGTAGCGAAACAAACTAGCCCAATACCGAGAGTTACTAATGCTAATAAATTATTTTTAAACAAC
      TGCAGTTAATGCGCTGATGTGTATATATATATATGGCATTGTATTAAACTGAATAAAATAAAAAAATAAAAACAG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0070404
      4599
      FBtr0070402
      4269
      FBtr0070403
      5069
      FBtr0307285
      4207
      FBtr0343597
      4653
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0298285
      1234
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0070388
      1234
      FBpp0070386
      1234
      FBpp0070387
      1234
      FBpp0298286
      1234
      FBpp0310194
      1239
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG2841-RD
      ptr-RD
      Secondary FlyBase IDs
        References (0)