Open Close
General Information
Symbol
Dmel\BtbVII-RB
Species
D. melanogaster
Annotation Symbol
CG43365-RB
FlyBase ID
FBtr0307302
Feature type
Associated gene
Evidence Rank
Length (nt)
3906
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 35 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          ATATGCGTTTTTCGCCAGGAAATCCGCATTAAAATAATTCGGAGCGAAAAAGTAAAGCGAACAAAACACCGGAAAGCAAG
          GAAAATTAATAAAAATCAATAGAGGCGAGCGGGAGGCGATAAAAAGTGTTATCAGTGCGAATTAATTGGCTACGAAGAAG
          GAAAGAAGCAGGAGGCGGAGGAGCGGGAGCAGGAGGAGGAGGTTGCTCCGGAGATTGAGGTTTAGGGAGCTCCAAATCCG
          CATCCCGGACGCGGATCCGGACCCCTCGACATCATGTCCGTGCAGCAGTTCTGCCTGCGGTGGAACAACCACCAGCCGAA
          CTTCATCTCCGTGTGCTCCTCGCTGCTGCACAATGGCACCCTGGTGGACGTCACCCTGGCAGCCGAGGGTCGCCAACTAC
          AGGCCCACAAAATAGTGCTATCCGCCTGCAGCTCGTACTTTCAGGCTTTGTTCACCACAAATCCGTGCCAACATCCCATT
          GTCATCCTGAAGGACGTGCAGTACGATGACCTAAAGACCATGGTGGACTTTATGTACTACGGCGAGGTAAATGTGTCGCA
          GGAGCAGCTGCCGCACATCCTCAAGACCGCCGAGATGCTCAAGATCAAAGGCCTAGCGGAGATGCCAACGGATCCGGCCA
          ATCTTACCAAGTCGGATAGCAAGTCCTCCACCGACGGCACCGAGATGGTGGGCGGTGCGGGAGTGGGCACTGGAGCGGGC
          AACTCGGCTGGCAGCCTGGGAGCCGGCAGTGGAAGCAGCGTCGGCGACTCCCTGTGGAGCAGCAGCGAGGCCCAACAGTT
          CCAGCAGCAGCAGCAACAGCAGGCCCAGCAACAGGCACAGCAGCAGCACCATCACCACCAGCAGCAGCAGCAGTTGCAGC
          AGCAACAACAACAGGCGCAGCAGCAGCAACAACAGCAGCAGCACCATCACCACCACCATCAGCAGCAGCAGAGCGGACAG
          GCGCAGGCGGCGCAGACGCATCACCACCAGATGCGACGTACGCCGTCGCCTTTGAGCGCTGGAACCTCGCCGGCCACCAG
          GCGCAAGCGCTTGCGCAAATCCTCGAATAACGGTTCTGGCGATCGCAACAACGCGGAGGAGCAGCACAACAGCTCACTGG
          ACGCGGGCAGTGGTGCCGGCAACGCCGGTCTCAGTCTCGCCCAGATGAACCAGATGACATTTGGTGCGGGCGGCGGCTTG
          GCCGGCCACTCACTGCACGCGGCTAAGCTGCTCAAGGAGTCGGCCAGCGCTGAGCTAGAGCAGCAGCCGCAGGACTCGGA
          TCTTGACGATGGACACGGACACTTACACATGCAAATTAAGCCCGAAGTCGACATTGGCGGCGTGAACCAAACGATGCCCT
          TGGACATCTCCGGCGGTACCACACCATCCGAGCACGATGCGCCGAACTCCCAGTCCTCGCACTCGGGTCTGCAATGGACA
          GTTGTTGATTCCAACTATCCGCGCTTCTCCCTGCCCGCCTGCCAGTCCAACTTGTTGGGCAACGGCGGAGGCAGCGGTGG
          TGGTGCCGGTAGCCAGAGCAGTGGTGCGAATAGCGCCGGCGGCGTCAATAGCGATCAGCGGCAGCAGCACGAAGCCCAGC
          AGCAGGCCACGCAACAGCAGCAGCATCTGCAGCAGCTGCACTACCAGCAGCAGCAACAGCAGGAGCAGGCCTCTGCCTCC
          GGACAGGCCTACTCGTCGCAGATCATTACCGTGAACAACCTAGTCGGAAGCTATGCGACGGCGGCCCAGAACCTTTCGCC
          CACCTCGCCCAATGAATCAAACATGGTGCAATCGGTCTACAGTCAGGGTCCGACGCCCACCCAATCCCCCGTGCACGCAG
          GAGTCGGTGGAGCAAGTGCGGCTGGCGGAGCAGCGGGCAATGCCAGTGCTGGAAACGGTGGAGCCCCTGGAGCGGCCAAC
          CAGGTGGTGAAGCGCAAGAGATCGGTGAATCCGCAGGGAGACGAAAACTTTATCCGAGCCCTGGAGGCGGTACGCACGGG
          AGGTATCGGATTCTGCAAGGCGGCACGACTTTACGGAGTGAACAACAGGACACTCTGGCTGGAATACAAAAAGCGTGGCT
          ATCCGGTGTCACGTCCCAGCATAAAAGCGCGTGTGGTCAAACAGGAGCCGAATCTGTCGCCCTCGCCGACGCCATCGACG
          AATCAGGGCGATGACAACACCAACGAAACGCTCGGCATGCAGATACCACCACAGGCGGAGACTCCGACACCTTCGCTCAT
          GTGCACATCGCACCACACTGGCCTGGGAAGCGGAGCTGGAAGTTTGCCGGCCGGAGGAAACTCGCACCCAGCGATCGGGG
          TGATGAGCCTGTTCGATCCTCGATACATGGATTCGCCCGGCAATGTGCACTCGATGACGCGGCAGCGTTACATCGAAGCC
          ACCGGCGGCGGAGCAGGTGCGGGAACGGGCGCAGGCACCGGCACCATCAACGTTAATCCGACCACCGCCATGAATCTACA
          GAGTATTAACTTCAACTCAATATAGAATACGATTTCGAGCCAGGCGGGGACGGCCACTCTGCTCCAGGCAGCCGCCGTAA
          TGGCCGCCAGCGAGCCAGCGGAATCCCTGAGCATATCAGCCATGCCCGTCTCCGTTCCAATGGGCATGGCGCACAGTTTC
          CTCATCAACAACTTCGTAACGGTGGCTGCACCGCCGGTGGCCACGGTGACCAGCACGGGCCTGCAGTACTTGGACAAGTC
          GTAGGTCCGGACACCGAGCCCCCAAATTGATCGATACAGGTATTAGAGAAACGGCAGCAATCTACTGTATATATAGCGGA
          CCGCTTGTACGGCACAGTGGCAATATATGCAGCGATATATGCCGACCCAGGATGGCACAGAAGTGGAATCGGATTCCTGC
          GCTGAGCTGAGCTGAGCTAAGCGAAGCAGGAGGATCGCAAGGAAGTGAGGCGGAAGTGAACGGCGAGGAGCGAAGCGAGT
          TAAGAGAGCAGGCAAGCCGGCCGCACTTGTAATAATACTTTCATAGAACCTAATTCCTTGAGCTAAACGTTTTGAACCCT
          ACATTTTTACGATTGTTAACTAAGAAATCGGTAGTGCAGATCTTCGATATACATACATATATATATATATATATAGCTAT
          ATAGCTATATTACGTGTAAAAGAATAATGTAATTGTACATAAATTATAAAATTTTATTAGTGTTAATCGCGAACATCAAA
          TGATTTGTAAGCAACTGCAGCTAAAAAGTGGTGCTGTGTGCCAGCAGCCGACACAAACCTTGCGGAATCCGCTCCATATT
          CCACTTTTTGTAATGCAAGCAAGCAATGGACTAAACCAAAAATTCTATCTGTAATCGTAATGATAAACATTAAGGACAAA
          ATGAGATTTATTGGCAATTTCTGGCGAAAATTTCCCACATCCTGCGGTTTGCTAGGCTCTGGCGCATCAGAAATAAGTTT
          TCTTCCTCGTTTCGAAAAGAATTTAATTTCTGCACTTGTGTTACAATAGCAAATACCAGTATGTAGGAACTCCCCGTGAG
          CATTATATTTAGCTTCCTATCAATGTGAGACCATTTTCTGTGTACAGTGACGCAAGTCCACTCTATTCGAAGCATAAGGT
          AATCGTTGGCGACTCCCGACTCCATGCCGCAGAATGTCAAGAGCAGGGAGATCCGAGGATCGCTGGACCGCGTACAATAG
          ACTAAGATACTAGATCGACGGAGGAGGAGGAGCATGTAAGCGAACCGGATATGTATGATAAATATGTACCAACCAATATA
          TATGTATATATATTTATATTTGTGAATGTATCCACACATTTTTTCATTTCCTTCTGAGTTACTCAAGGTGTCAATTCCTG
          TTTTTATGGCTGCGCTGGCACCTGGTCCTACGGTGATCGACTCTAGGTTATATATTTTCAAATCCG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0307301
          3321
          FBtr0307304
          4752
          FBtr0307305
          4016
          FBtr0307306
          3943
          FBtr0330148
          3321
          FBtr0330149
          3336
          FBtr0332096
          4042
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0298303
          743
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0298302
          743
          FBpp0298305
          743
          FBpp0298306
          743
          FBpp0298307
          907
          FBpp0303181
          816
          FBpp0303182
          748
          FBpp0304406
          747
          Comments
          Extended 3' UTR based on RNA-Seq and/or EST data.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          BtbVII-RB
          CG43365-RB
          Secondary FlyBase IDs
          • FBtr0073025
          References (0)