Open Close
General Information
Symbol
Dmel\Cadps-RE
Species
D. melanogaster
Annotation Symbol
CG33653-RE
FlyBase ID
FBtr0307334
Feature type
Associated gene
Evidence Rank
Length (nt)
5413
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 55 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TTCTCCAACTTAACTATTCTTCAAACGGAAATCCATTTATTCATATGTGAAAATAGAGAACTGTATAAATAGAAGTAGAT
        AATTTGTGAAATAAACCTGATGTCGCCTTGAAAATACATAAAAAACTTATATTTTTGTCAATAATTATACTATGAATTTC
        GTTTGTCATTCACATAGTAAATGAATTCAAAGTTTTGTTATCGTGTAACTCGAATTCATATAAATAGTGATAAAGTTTGT
        TCATAATTTAAAGCTATATTATAAGCACCATACATTACCGAACGACAAGCATAAATCTAATATTTAAGGATTAAAAAACA
        AGTAATCGCGTTCCGCTTATTTTTTTACCATGATTGATCCTAGTTCAAGTGAGGAAGAAGGAGAAGATGACGCTGTTCCT
        AACGTTTCATCAAAAGGACGTCTTACAAATACGACCAAAGGAACAAGTGCCGTTTCTATAATTGGAGGATCTGCAGGATC
        CGTCGTAGGATCAAACATTCCTGTATCTGGCTCTAATACAGATTTGATCGGAAATCAAAGACAATCTAATATAAGTTCTA
        TTTGTAACCGCAACGATGTTGGGAACATTAGTGTAGCAGCTTTAGGATCAACCTCTAACAAAATTGAGCAAATATGTGGC
        AACCGAGCTGATACCGGAAATCTTGAAGTTCCCAGTAATGGTATTCCGAGTGGAATTTCGCAAGAAACTTTAAATCAAAG
        TGTTGGATCGTCAAGGGCAAACTCATTGCCAAGGCCATTGTCACCGTCGCCATCTCTAACCAGCGAAAAACATGAAACTG
        CAGAGCCGCATGGCAAACATGAACGTGAAGAAGAGGAACGTAAACGACGAATTCAACTTTATGTATTCATTTCAAGATGT
        ATTTCATACCCTTTTAATGCTAAACAGCCGACAGATATGACTAAGCGGCAAACCAAAATAAGCAAACAGCAGTTGGAAAT
        TATAACTCAGCGATTTCAAGCGTTTCTTAAAGGCGAAACTCAAATAATGGCAGATGAAGCATTTCAAAATGCTGTGCAGA
        GCTACCATGACGTATTTCTTAAATCGGAACGAGTTTTAAAAATGGTTCAATCTGGTGCATCATCACAGCACGATTTTCGA
        GAAGTTTTTCGTAATAATATAGAAAAACGTGTCAGATCTTTACCTGAGATAGATGGTCTAAGTAAAGAAACCGTACTAAC
        TTCATGGATGGCGAAATTCGACATTATATTAAAGGGTACTGGGGAAGAAGATTCTAAGCGACCATCTCGAATGCAGCAAT
        CACTGAATAGCGAGTTAATTCTTTCTAAAGAACAATTGTATGATATGTTTCAACAAATATTGCTAGTAAAAAAATTCGAG
        CACCAAATTTTATTTAACGCCCTGATGTTAGATTCTGCCGATGAACAAGCAGCAGCTATAAGACGGGAATTGGACGGTAG
        AATGCAAAGAGTAGGAGAGATGGAAAAAAATCGCAAACTAATGCCCAAGTTTGTACTTAAGGAAATGGAGTCTCTTTACG
        TTGAAGAACTTAAATCGTCTATAAATCTTCTGATGGCAAATCTTGAATCTCTTCCAGTGTCAAAAGGAAATATGGATAGT
        AAATATGGACTCCAGAAATTAAAACGTTATAATCACAGTACACCGTCGTTTTTAAAATTGATACTGCGATCTCACGGATC
        TTTATCTAAGTTGGAGGGTGATTCAGAGGATGGTTCCACACAATTGACAAAGTTAGATGTTGTACTAACTTTCCAACTGG
        AAGTAATAGTTATGGAAGTTAAAGGTCTTAAATCTTTAGCTCCCAATCGCATTGTTTACTGCACAATGGAAGTTGAGAAC
        GGGGAAAAGCTTCAAACGGATCAAGCCGAAGCATCAAAACCAATGTGGGATACGCAGGGCGATTTTACAACCACACACCC
        ACTGCCAGTTGTCAAGGTAAAACTGTACACAGAGAACCCCGGAATGCTGGCATTGGAGGATAAGGAACTGGGAAAGGTAA
        CACTTAAGCCTACTCCACTTTCTTCAAAGTCACCTGAGTGGCATCGAATGATTGTACCGAAAAATCTTCCCGATCAAGAT
        ATACGTATTAAGATAGCTTGCCGACTTGATAAGCCATTAAATATGAAACATTGTGGGTATCTTTATGCTATTGGGAAATC
        AGTATGGAAAAAATGGAAAAGGCGTTATTTTGTCCTAGTTCAAGTATCCCAATATACTTTTGCAATGTGCAGCTATAAAG
        AGAAAAAATCAGAACCGTCTGAAATGATGCAGCTTGATGGATATACTGTTGATTATATAGAAGCCGCCAGTGCAAATCTT
        ATGTTTGGAATCGATTTGAATGGAGGCCGTTATTTCTTCAATGCTGTTCGAGAGGGAGATAGCATTTCGTTTGCTTGCGA
        TGATGAGAACGAATGCAGTCTTTGGGTCATGGCTATGTACAGGGCGACTGGACAGTCCCACAAACCAACTCCACCAATAA
        CCCAAGATAAGAACTCAGCTATGTCGAAAATTCAAGACGCAGATAAAGCCCGGAAACATGGAATGGAGGATTTTATAAGC
        ACCGATCCTTGTACTTTTGATCATGCTACACTTTTCAAGACGTTACAGAATCTTACACTGGAGTATAGGCTCAACGACCC
        ATATGCTTCTTTGGGGTGGTTTAGTCCTGGTCAAGTTTTCGTGTTGGACGAATATTGCGCTCGATATGGTGTCCGAGGAT
        GCTACAGGCACTTATGCTACCTTTCTGATTTACTGGATCGTGCCGAAAAACAACACATGATAGACCCAACTCTAATTCAC
        TATTCATTCGCCTTCTGCGCGAGCCACGTACATGGAAACAGACCTGATGGAGTTGGAAGCATAACACATGAGGAAAAGGA
        GAAATTTTCTGAAATCAAAGAACGCCTACGCCAGTTACTCGAATTTCAAATAACCAATTTCAGATACTGTTTTCCATTTG
        GTCGCCCCGAAGGTGCACTCAAAGCAACATTATCCCTATTAGAGAGAGTTCTAATGAAAGACATTGTTACCCCCGTTCCA
        CCTGAAGAAGTTCGTCAAATGATTAAAAAAAGCTTAGAGACGGCAGCGCTTGTAAATTATACGCGTCTTTCCAATAAGGC
        TAAAATTGATGAGGACTTGCGAGGAGACGTTATTGTTCCGGCCCCAAAAAAACTAGAGGACTTAATACACTTAGCAGAAC
        TTTGTGTTGATTTGTTGCAACAAAATGAGGAACATTACGGAGAACTGCGCAAACATGATAAAATGGATAAAAAGAAATTA
        CTTAAGGAAGATGAAGATGTATCAGGAGGCCACAATGAAAGCGAAGTTGATTTAATCGACAGTACTGGACTCATTAGCGC
        ATCTGAACTGGCTACTGCCGCATCAACTGATGGATCGTCATTTCGTTACTGTATGCCGACTCATGCAGTGTACACCCCGC
        CAGTACCAACGGCATTTGCATGGTTTAGTGACTTGCTTGTGGAACACGCGGAAATATTTTGGTCTCTCTTTGCTGTTGAC
        ATGGATAGAGTCTTATCAGAACAAGCTCCTGATACGTGGGACTCTTTTCCATTGTTTCAAATATTAAATGATTACTTGAG
        AACTGATGACAATTTGCGAAATGGACGCTTTCATCAGCACCTTCGAGACACTTTTGCACCTTTAGTTGTGCGATATGTGG
        ATCTGATGGAGTCTTCAATAGCTCAGTCAATTCATAAGGGATTTGAAAAAGAACGATGGGAAAGCAAAGGAAACGGGTGT
        GCCACTTCTGAAGATTTATTTTGGAAACTAGACGCTCTACAATCTTTTATAAGAGACCTACACTGGCCAGACGCAGAGTT
        TCGACAACATTTAGAACAGCGCCTAAAAATGATGGCGGTGGATATGATAGAGCAATGTATTCAACGAACTGATTCGTCCT
        TTCAGTCATGGCTAAAAAAAAACATTGCCTTCATTTCAACTGATTATATATTGCCCTCTGAAATGTGCGCCATGGTCAAT
        GTGATATTAGACGCTAAAAATCAAAGCTTTAAATTAACCACTATTGACGGCATTGATTTGTACAAGTTTCATGCGAAAAT
        TGATGACCAAATCGACAAAGCGAATGTAGCTATGACACAAGGTCTAAGCGGTAAACTTATGTCTGTGCTAGAGTCGACTT
        TGTCTAAGCTAGCACGATACGATGAAGGTAGCTTGATCGGCTCAATTCTTAGTTTTACAAATGTTTCAAGCTCAGGAAAG
        GATCTGGGGCAAGGATACGTAAATTTCTTCAGGAACAATATGGATCAAGTACGAGGAAAGATTGCCGACGATTTGTGGAC
        ATTACATTTTTTTGAACAGTGGTATTCGCAGCAGATTAATATGCTGTGTAATTGGCTGTCGGAACGGGTGGACCACGCCC
        TTCACTATGCTCAAGTTGCATCTATTTCTCATATTATCAAGAAAATATATTCAGACTTTGAACTACAAGGTGTATTGGAA
        GACAAGCTGAATTCAAAAGCATATCAGGCAGTCGCACAGCGAATGGCAACAGAGGAAGCAACTTGTGCATTGACAATGCC
        TGACGCTTGCGAAGATGAACCCTGTGACGAAATTCGAGAAGGGGAGGAAGAAGACAATGGCGATGAATCTACATCTAATA
        TACCAAGGGGCTTGCCAAAACCAAAAGTCGCTGCCGCCCAAGCTGCTGCTGTTACCAACGTAGTTGCCGGACGGGTGGGA
        AATTTACTGGGAAAAGGCATTGGTGGGCTTAGTTCAAAGTTAGGAAGTGGAAGTTGGTTTTAGACTTGACCAGTATTTTA
        AAATCATTATAAAAATTATACATTTTTTAAATTTCTCTCTTTATTCAAACTTGTATTATTTTATATTTTTAAAATGTAAG
        ATGCTATTAACATCCCTTAAACGTATTTTATTCCCTTATCAATAAGTTATTAACACAGAACAAATAACTTCCTAGGCACA
        ACTACATATGTCCCTTGCTTCTTGATATTTCATATAAATTATTACCCAATGTTCTTTTTACCTGTAACTATTTATGGATT
        ACTTAATATAAATAAACGTATAAATACATTATTATATTCATCGTTTAATTTTAGAATGAAATATCTATATATATACTTTA
        AAAGTGAAAGCATAATCTAAACACACATATAAACACAATATTATATTTATTTCATTTTAGGAGAAAACATTTATATACAT
        ACTTCTAACTTGAAATCATATGCTTCAAAAACCTATGTGTTATTCTATAATTTTTAAAAATGTTATATTTCTTATTTAGT
        ATCCCCACCCTATATTCTAAGAGTAACGCATAATTTACATTCAGAAAATAAAATTACTATCAAATTAACTATTATGTGTT
        AATAAAAAACTAATAAAATAGCGCGCTTTATTTTACGGAAAATAAACCACCTT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0091630
        5569
        FBtr0091631
        5317
        FBtr0307333
        5584
        FBtr0333702
        5079
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0298335
        1477
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0088329
        1529
        FBpp0088330
        1445
        FBpp0298334
        1534
        FBpp0305855
        1409
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        GC splice donor postulated.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        Cadps-RE
        Caps-RE
        Secondary FlyBase IDs
          References (0)