Open Close
General Information
Symbol
Dmel\jv-RD
Species
D. melanogaster
Annotation Symbol
CG32397-RD
FlyBase ID
FBtr0307514
Feature type
Associated gene
Evidence Rank
Length (nt)
6202
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
          End(s) extend beyond the annotated transcript, internally consistent
            Sequence
            TTTTAATTTTCAGTTAACTTTCAGATTTTCGCGCTAGCAGACGTGTGCGTCTCTATCTCTCGACATTTGAGTGGCGGATA
            ATTTGTGTGCCGCCTGCCACCGACACGAAAATATTAACTACACGAGCTCCCCGTGGAAGGTCGACCTTCGAGTCCGGCAC
            ATTTTGCACGTCAAAATAGGCTCCGGACAGAGTCACAGCCTCTGCTATGGCGGCACGATGGGCAACGGATATTTTCGAAC
            GTCACAAACGTCGTCGTCGTCACGCCAGCGGGAAAAGCGAGGCAAGGACAGCTATAGCTATCAGCACAATTACGTGGATC
            GGGTGCGTTTAGAGGATACCACTGGTGGACATTACCACAACAATCAGCACCAGCAAACCACACACGATCCGAGGTGTCCG
            CAGTTGAGAGCCGCTGGCTGGAGACACACGCACAAATCCGTTTCCCATCTCGACTTGGCCACCAGCTGTCATGATGCAGC
            TGGAACTGGCTTAGGTCGCCACTCGCAGCAGCTGCACCACCACCACAGCAATCAGGTGAATCAGCACCACCACCAGCAGC
            AGCAGAGTCACCACCATTTGCAGCACGCCAACTTGCACTCCCACCATCCACACGCCCAGCCCCACTGGACGCAGTGCCGG
            GTGGGCGGGGCCGGAAGCGGAAACGGGCAGCTGAGGAACGCCCGATCGCTGGACTACACGCAACTCGAGCGGGAGGAGAA
            CGCCTTGGACATCGCCGAGTTCTATTGGCGATTCGATGCGGAAGCTCCGCTCGACCAAGTCGATAGCTACGCGGTACTAC
            CAATCAATGACAACTTTGAGCCTTCGGCTGCAACATCAACGGCTGTAGGATCAAAGGAGACAACCACCACAGTAGCCAAC
            AAGGCAAATGGTAGTGCCACCACCAACGCAACCACTGCCGCTGCAAACGCCCTGCTGGACATTTTGGGCAGCGAATCGTG
            CAGCTTGAGAAGATCGCGCAGTTTGGCCGTAATACGTGAGGAGACATTTAGCGACCTGCAAATTGGATCGGCCAACAGCA
            GTCGTCGCCGATCGCAGCTAATACCGCGTGCCCGGCTCGTTAATCGCGGATTTTTCCGTGAATCGCCCCGGTCTCGGCAC
            AAATTTCAGTTTAAACAATTCAAAAAAAAGCCGCCAGCCAAATTGTTGCGATTGAACGGCAAACCGAATCAGGCGACCTT
            GGTGGGTGAGCAGCCAGCGGATCAGCCTACGGCGGATGACACCCAGAGCCAGAGAAGCAACTCGGCCACTTGCGATTCGC
            ATCAGCAGCAACAACAGCAGCAGCACCAGCCGCAGCAGCAACATCAACAGCAGCAACATAGGCTTAGTGGAGAATCGCGT
            GACTTTGATGTCTACTATGATAATCTGAAACGCTTGGACGCCTTGGCTTTGAATCTGAGTGAGCAATTGCATCCTTGGCA
            CAACGACAAGAGCGACTTGGAGAGCTTGAACTCGGATTACTTCAAAAATTCATTGCATCAGAACCATCTGGATCAACAGC
            AACCATCATCCCTGGAATTCGAAGCTCTCGAACAGGTGGCAGCTAGTTTGCTAAAGGAAAGACCAAGGATTTATCAATCA
            AGGCGGCAGCAGCAAAAAAGGAATAACCATCATTCCAACTGCCTGCAACGACACCTCGACACTGGGGGAGAATCGTGTCC
            AGAACACAGTCAGAGTAGTGTTTTCCCAGAGACTACAACCAGTAACTCAGATGATCAGACCGATAGTCCATCGCTATCGG
            AACAGGAATACGACTTAACCCACATTGAGGAGATCTACCAGCAGGGTAACAACGGTGAGGAGAGCTACGAGATCATAAGT
            CTTACGACCACAACAAGGACACGTTTCGAGAGCAGTGAGGAGGGCGAGGAGGAGCAAACTGGAGAGGAAGTTGTGGACAG
            TCTGACCACGCCCACGGAACCACAGACCAGCGATAGTGAGAGCACCTTAAGGCAAAACCACAACGAACAGTTGGACAAAC
            TAATAGCTTATGATTCTGTTTACCTCTCCTCAGAAGATAGTTCAGATTGTACTTTAGTTGGCGAAAGTTGCGAGTCCTTC
            GAGCAGAGAACTTTCACTAGTTGTGGCGAAAGTGGCGAGTTGGAAACCCGCAGCTTACTACACATTTCAATTGAGGACAC
            GGTTTATGAACCACAAGCGAAGCAGCACAAAAAGGCCACAAATCAAGAAGATCAACCTGCTCCTCTGTTAACCACCACAG
            CCAAAGTTGAGGCACAGATCTTTACGCAAGTTTTGAAGGTAGAACACACTCCAAAACCGAATATCCTAGCTGTAGTGGAA
            AAACGTAAGCTCAAACAGGAGGAAGTCAAGCACCAGCCGCCGGAACTGAAACGCCAGGCAACCGACTCCTTCGTGGTCAC
            TGCCAACAAGTCCAATCTCGCAGAGAATCAGTATCATAGCCTGCCGGATGTTAACATAGGAGTTAGTCTGAAGGTCTGCG
            AGAGCATCGACAAGGAGCTTAGATCATCCTACAATCAGCAGAGGCAGCAGCAACGCAAGGAAGCCAAAAAGGAGCAGCAG
            GTGACGCGGGCAGAAACGTACGATTCCATTAGACGTTTCGGACGCGCCCATCAAAAAGCCAGGCAAAGGGAATACCAGGA
            AAGGGAAAGAGAACGTGAAAAAGAAGCGTCAGCGGCTCTTCAGGAAAAGGACAAGGAAAGGGAAAGAGAAAAGCCAAAGA
            TAAACAAGGAATTTTCCGCACAGGAGCGGCAAATTGAAGTGAAAGAGACGACAAAATCTCAAGATATAATCAAAGAAAAA
            GAGCAAGTTTCTAGAAAGGAAGAGGCTGAGGACGACGAGGAAGAGGAACCACTGCCACCACCGCCGCCACCTTTGACCGA
            GGAGTCTCAACAGGAGGACACTGTAGCGGATGTAGAAGAGGAGGACAATCTGTCTGTATCCATTTCACAGCCGGAACAAC
            CCAAGGAGGCGCCCGTCATCGAGGTGGCCAATTTCAGCAAGCTAATCGAGCGTCGTGCCCAGGAAATCCGCGAGCGACAG
            GAGCAAATAAAGCCATCCTTTCAAATAATCGTCACCGACGCTCAGAACAATATCATCCAGAAGGAGGCAATTCAGGAGAA
            CAAGGAAACCAGCCAAAGGATTGAACCCAAACCCAGCCCGAAAACAAATTCTAACTCAAGCTCAACTTGTAATCTCGTTC
            AGCGCCCTCTTCGCCGCTCTGTGAGTTCCTCGAGTGGCAAACCGCTGGAACATCGCATCCTCAGCACTGGTGCCCCAATT
            TACAAGGCCCGACCTGTCAGGGTTTTGCCCTCCTCCAGCAGCGATTCGAGCTTTTCCAGGGGCAAAATGTCACGACCCCA
            AATACTTCATGTGGTGGATGGGCGTGGAGGAGTTGCGGGCGGAGGAGCAGGTGGCACCCTGCGAAGAAGAAGCAGTGCCA
            GGAGCATAGCCAGCACAATTAGCTCGCCGGGTGGTGAGGTGGCTAATGAATATCTGCAGAAAGTGGATGCAGTCCGATGC
            TATTGGAACAAACTTGCGGGCAATGAACCAGAAACATTAAAAACAGAGCAGCCGGCAAAGGAAACCCAGCCAGGCATTCA
            CTTCCAGTTGGGTGGAGAGACCACAACACAAGGCACGGATAAATCCGCTGTTGGCAATGACTTCTGCAGCATGATGCCAC
            ATCCCTCAATTGAAATTGTAGAACTAGGAGAGGGTGCCCAAAAAGCCACCATTGTAAAGGCAGCTCCGGAACGAGAGGAG
            GATCCAGATGAGGATCAGGATCAGTTCGATCACATAAGGTATAAGGTTCTGAAGTCACAGCAACTGATTCGCAATAATTT
            CCTCTCGACCAGAAATAAAAAGGAGGCCCAGTTTGATGGTCTAATTCAGTACCTGCAGGAATATAGTTTCCAGGAGTTGC
            TGAGCAACAATAATGTGGTGATAGTTGAGCCTGTAAGGACCAAGATAGAACGACCTCTGCAGGTGGGAATTAACAGTGGT
            TCTACAACTACGCCTACGACTGTTCCACCCCCGAAGCCTCCACGGGTTGTTAATGCCTCTGCTTCCCAGCCACGAAAAAC
            GCGGCAAAAACAAACGGGAGGTGCGGCTGCCAAACGACATTTCTTCTACCAACCCGTGCGGGTGAACAGAGAGCTCTACG
            AAGATGAGCTACCAGATCCTGACACAGTTCGCAATGTTCGTCGCTTTTTTGAGCAGAATGTCCTGCCAACTCCCGGTCAG
            GGATTATTGGTACAATCTCAGCAAAAGTTTGGTGGCTCAGCCTGCCAATTGAGTCCCAAGTCGAGGAGAGCTAGGGGTTA
            CCGATACCTGACAATTGATACGAGTTATGGAGGAGCAGAAGAACAACCCAAAGGCATGGAGATGCTGGAGGAGCACAAGG
            CGAAGCACTGGGACAATGCCAGCCTATCAAGTGGAATTTCCAGTGGTGTTTTAAGTTCCCCCTGCGGGGAATATCATCAT
            CAGGAATCCCCGGTGATGGCCTGCAAAGATGTCCATGTTCAGGACGTTGTTCGGAGGCACAATAGCAATGCTGCCAATGC
            CAAAGCTCGAGCTAAATTCGCCAGCCGACGTACCTGGTGCATGGGTGCTGGAGGACCAGGAGCAAATGAATCCCTTTATC
            GGCAAATTTATGAAAATAATTTGGGAAATTCAGAGCAGCAGGAAAATGGAGAACATCTGGAGGAAGAGGACGACGAACAG
            GATGACCAGTATGAGGACGATGTGGAGCAGGACATGTGCGAGAATTATTACGTCAGCAATGACGTGCTGGCCAAGATAAG
            GGAGTGCGGCTCAACTGTCACCTACTACGGAGGAAGAGTGCTGGACAAAACCGCAACCAGCACCGCAGCTCCGTCGACAA
            AAACCACTCAACCGATGACGGGTAGTGCCACCCGCTCCCGAATCCGTCAAATCGAGGCCTGCAATGTGTGCCTCCCGAGC
            GAGAGATGCGAACATCGATTGCAAACCAAACAAGCTGCAGCTAAGCAGCAGCAGGACTCTTATCAAGGCATCAAATTTAA
            GCTGGTAAAGTCGAACAGCTGCAGCAGTCGCCTGGAGTTGGCCGGAACTGGAGAAGATGAGGTCACCGCCGACAGCGAGG
            TGGTTCGAAAAATGGTACATCACTTTGAGGCGAATCAGACAACGGCAAGTAATGATGTCCAAGTGACCATCAACAGTCAG
            AGTCAGATAACGTCAACGAAAAAGGAGCCGGAGGAGGATGTGCCGCGCCGCCAAGTGACAGTAAATAATCACATCAATGT
            GCTTGGAGACACGATGCCCCAGGCGTCCCAGGAGAAGGCTGAAAACTTTAATGGCCGGCCGGAGGAGAATGGCTATGGCG
            CTGTGGAGACCGTGCCCACATACGAAAGTCAAGCCATGAACATACGCCTCGATGCGACTGAAAATAAGAATATCCTGCAA
            ACTGCCGCTGCGACTGCTGCTGCCAACAAAGTTTGCCGCAATAAAAACGTTGACTTGGCCTACACGTTGGTGAAGACAAC
            GACAAATTCTCCCAAGGGCAAGCCCATCGAAGCTCCGCGCCAGAAAATTGGAAAACAACTGCGCGAAGTTGAGGAAAATG
            TGGAAAAAGCAGCCGTGACAAAGGCCACCATCAAGCTGACGAAGGGCGCCCCATCGCAAATCATTGTGCCCGTTGATATT
            CACAGTCAGGCCTCGATAGTTGCACACACTGCCCCGATTCCAGAGCGTCGACTGAGCAATGCCAGCAGCAGTAACTCGGT
            GGTGGACAAGACCGTAGTTCGGCATTATGTGGCCAATGATAAGAGCATCTACGAGCGGCGCAAATATGATGAGATTGAGT
            TCGAGGAGTTCGAGGTCTACGATCCCAGCAAGGAGCCACCACCCCAAGTGGAGGAAGGAACCGACAAAATACCCACAGAT
            GCAGAGCTCTACGACAGCCTGGATGACAAAATGTAATCAGCAAACTAATGCTCAATGGAAACACAAACGGCAACGACGAC
            TTCTTGGGGTTTTGGGTTAAAGCTTAAATCTAAACACACATCTCGTAGTTAACCATATTGGTAGCCTAATTTAGCTTTAC
            AGGTAAAGCCAAAAAGATTATACCATAAACTATCCAAAGTATGATATATTTTAATATTTAATCTTAATTTGCAAAACCAA
            CTTTTGTCCAACCGTACATTGTAAGTTTATGCTTAAATAAAT
            
            Other Products of this Gene
            Other Transcripts
            Name
            FlyBase ID
            Length (nt)
            FBtr0307512
            6142
            FBtr0307513
            6376
            Polypeptides
            Derived from THIS transcript
            Name
            FlyBase ID
            Length (aa)
            FBpp0300169
            1912
            Derived from OTHER transcripts
            Name
            FlyBase ID
            Length (aa)
            FBpp0300167
            1892
            FBpp0300168
            1892
            Comments

            Splice acceptor site of Exon 5 of this transcript is based upon RNA-Seq expression data.

            UTR(s) based on RNA-Seq data.

            External Crossreferences and Linkouts ( 1 )
            Crossreferences
            RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
            Synonyms and Secondary IDs (2)
            Reported As
            Symbol Synonym
            CG32397-RD
            jv-RD
            Secondary FlyBase IDs
              References (0)