Open Close
General Information
Symbol
Dmel\faf-RD
Species
D. melanogaster
Annotation Symbol
CG1945-RD
FlyBase ID
FBtr0307547
Feature type
Associated gene
Evidence Rank
Length (nt)
9163
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 24 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TCCATTTGCGAAAAATAAATGTACGTGCGCGTGAGGAAGTGTGTGTGCGCGTGAAAAAACAGTGAAAAATAATAAAAAGC
        CGCACTGGCCGCCGTCCTTGGGTGACTTCCGTTAATCTCTTACAACTTTTAAAGCTATAGAAAGAATATTTTTGCAAACT
        GGCCGCTGACCAGGCATTGGGAAAAAGGACAATAAGAGGGAGCCCAGAGCAAGAAGTCCAACTAACCGACCAACTGTGCC
        TCAAGAAACAGCAAATCAGCGGGGAACTCCCAAACTGGACAAGCAGAAGCCCGGATACCTCACATTTGCCATAAGACACC
        AGTCAAAAAACGACGCGCACTGCAGAACGCATTAGGATTAGCCCGGCACTAGAGCTCGTGCATTAACATCCGCTTCCGGT
        GCTCCGCAGAACGAGTTGGCTGGAGAGGATACCCCGCCACCATGACGTTCGACACTCGTAGGCACACCACCGGACAGCCG
        GGAAGCACAGCGCCCAGCTCAAGCAGCAGCACCACCAGCACAACAACCACCACAACGAGTCCGGCGCAGAGTGCCGGATC
        AGGATCGGGCATAGGAACAGGCACAGGAACAGTCGCCAACTCGAGTCTGCCAGGAGGAGGATCAGGTAGCTTGGACGGCA
        ACCAGGATCAACAGCCGGCCACAGACAGTCAGAGCTCTGATGACGTGGCCGCTTCCTTGTCAGCGAACAGCGTGGACAGC
        ACCATCACAATAGTGCCTCCAGAGAAGCTTATATCCTCGTTTCCCACGACGAAACTGAGATCACTAACGCAAAAGATATC
        CAATCCGCGTTGGGTGGTGCCGGTGCTGCCTGAACAGGAATTGGAGGTTCTCTTAAATGCAGCCATCGAACTGACCCAGG
        CTGGTGTGGATCACGACTGCGAGCCATGTGTGGAGTTTTATCGCAATGGACTGAGCACTTCCTTTGCCAAGATCCTAACC
        GACGAGGCGGTGAATTCGTGGAAGAATAACATCCACCACTGTATCCTTGTGTCTTGCGGCAAGCTTCTACATCTAATCGC
        CATCCACATGCAGCGAGACAATCCCTATCTGCTTGACTTGCTGGCTATTGTTTTTGATCCGGAGAACAAGTTCAACACAT
        TTAACGCAGGCCGTCAACCGGAGTGCTTCGCAGCGCCGGACTACATCTGGGGTCAGTTGGACAGCAACAAAATGTACGCC
        CGTCCGCCGCCGGAGCCCAAGAATGCGCGTGGCTGGCTTGTGGATCTTATTAACCGCTTCGGACAGTTGGGAGGCTTTGA
        CAATCTACTGGAACGGTTTAACATCGGACTGGAACTGCTGAAGCGCAACCAAAACAAGTGCACTGGCAAGAATATTAGTG
        TCGAGGGTAGGGTTGAAAATGGGGCTCAGGATAATCGCCTCACCCTTGCCCTCATACACAGCCTCTTGCGTCCATTCGGT
        CAATGTTATGAGCTTCTAATGCCTGCCACTATAGCCAAGTACTTTATGCCCACCTGGAACGTTGTGTTAGACCTTCTGGA
        CAGCTTCACAGACGAGGAGTTAAAGCGAGAAGTGAAACCTGAGGGACGCAATGACTACATCAATGGGATTGTAAAGTCAG
        CCCGCTTACTGGCCAGCCGCTTGACTGGCCAGGAGGAGCTAATCCGAGATCTTGAGATGTTTCGCCTAAAGATGATCCTG
        CGTCTGCTGCAGGTGTCCAGCTTCAACGGCAAGATGAATGCCCTTAATGAGATCAACAAGGTGCTCTCCTCGGTCGCATA
        TTTCTCCCATCGATCCCAACCTTTGCCCCACTGTATGCCCGAAGACGAAATGGACTGGCTGACGGCGGATCGCATGGCGC
        AATGGATAAAGTCGTCAGATGTATTGGGTGTCGTGCTCAAGGACTCGCTACACCAACCGCAGTATGTGGAAAAATTGGAA
        AAGATCATCCGCTTTCTTATTAAAGAGCAGGCACTAACGTTGGATGATTTGGATGCAGTTTGGAGAGCGCAGGCCGGCAA
        ACACGAGGCAATCGTGAAGAACGTTCACGATCTACTGGCCAAACTTGCATGGGACTTTACTCCCGAGCAACTGGATCACC
        TCTTCGAGGCGTTCCAGGCCAGCATGACCACTGCCAATAAGCGGCAACGGGAAAGACTTCTTGAGCTAATACGCCGCTTG
        GCTGAGGATGACAAAAATGGTGTGATGGCCCAAAAGGTGCTTAAGCTGTTTTGGACTCTGGCCCACAGTCAGGAGGTGCC
        GCCAGAGGTGCTTGATCAGGCGCTGGGCGCACACGTTAAAATCTTGGACTACAGCTGCTCGCAGGAGCGGGATGCCCAAA
        AGACCATTTGGTTGGATAAGTGCGTTGACGAACTTAAGTCAGGCGATGGATGGGTTCTGCCCGCCTTGCGTCTAATCCGG
        GATATTTGTTGCCTATATGATACCACGACAAATCATGCCCAGCGCACTCAAACGAGTACGAATCGTCAGCAGGTGATTGA
        ACGACTACAGAATGATTATTCCTTGGTCATTCTGGTCACCAATAGTTTGACTGCATACATGGAAAAGGTACGCCAAATGG
        TAACGGACTCACCAGGCCTGGATGCAACCAGAATCCTAATTGACGGAAGATTTCCGCATCACGTGCAAATAGCGGAGCGA
        CTGGAGTTCCTTAAGTTCCTGCTGAAAGATGGACAGCTATGGCTGTGCGCAGATCAGGCAAAGCAGATTTGGCATTGCTT
        GGCGGTCAATGCAGTTTTTCCGGCAGATCGTGAGGAGTGTTTTAGATGGTTTGGCAAGTTGATGGGTGAGGAGCCTGACT
        TGGATCCTGGCATAAACAAAGACTTCTTCGAGAACAACATCCTGCAACTTGATCCGCATCTACTAACCGAAAGCGGAATC
        AAGTGCTTTGAGCGCTTCTTTAAGGCTGTCAATTCCAAAGAGGACAAGCTGAAGGCGATACATAGAGGTTACATGCTGGA
        CAACGAGGATCTAATAGGAAAGGACTACTTGTGGCGGGTCATTACAACTGGAGGCGAGGAAATCGCCAGCAAGGCCATTG
        ATCTACTTAAGGAAGTGTCGACGGCATTGGGCCCACGTCTGCAGGAGAATATCGCAGAGTTTCATGAAATGTTCATTGGT
        GAGTGCTGCTCCCGCCTGCGCACACACTATGGAAATATCGTTATATTGGGCAAGACGCAGCTGCAAGAGGAATTAGATGC
        CCCCGATCAGTCGGATAATACCAACGACGAGTCTAAAGATTCAAAAATGCGTTTCATCGAGGCGGAGAAGATGTGCCGAA
        TTTTAAAGGTGCTGCAAGAATACGTAAAGGAGTGTGATCGTTCTTTCAGCGGCGATCGTGTTCACCTGCCACTTAGCCGG
        GTTACACGGGGCAAAAACACCATCTTATATATCCGCTTCCAGAACCCTGGCAGATCTATCGACGACATGGAGATCGTTAC
        ACACAGCAACGAGACGATGGCCGCTTTTAAGAGAAATCTACTTAAGCGAATCAAGGGAACTTCGACGGCCAACATAAAGG
        TTGATCTCTTCTATGCTAATGACGAGATGATCGGGGTTTCCGATGAAATAAACCCACTTTATCAGTACACTATCCGGGAT
        AAGATGAATCTTACAGCAAAACTCACGCCCGTGGGTACGGGTCTAGCCAGCAGTCCCGACTCCTCGAGCGACTCGAGCAC
        AGGATCTCCTCCGCGTCCCTGCCCTGACATGCAGCGTGTGGAGTCAGAAAGCACGCTACCCGGTGTGATCATCTCGCAAA
        ACTACCAGTACACAGAGTTCTTTCTAAAACTGTACCAACTGGGCAGTGATCTCGAGCACGGTCGTCTTCGAGACAGTGCA
        AAAGTTTTACTACACCTGCTTCCCTGCGACCGCCAGACGATCCGTCAGCTAAAGATTATGTGCAAGGTGCCGAAGGCTGC
        CGTAACGGTGGCTGTGACGGGTGACAAGATCGCTAAGGATGAGGAGGAGAAACTGTACCCCACTGAGCAGGCGGGGATTG
        AAGATGAAGAGGAACACTGCACGCCAGAGCAAATGTTTTTGCACCCCACACCTGCTCAAGTGCTATACAACCTTAGTGTG
        TTGCACGGACTGCTGATTCCCGCGCTAGATCCACTAGGAGAAAGTGCCCTACTAGTGCAGTCTGCATGGATGCATTCTGG
        CTGCGCTCATTTCGTGCTGGAACTGTTGACCAAAAACAATTTTCTGCCTAGCGCCGATATGCACACAAAGCGTGCGTCCT
        TCCAGTGTGTGTTGAGGTTGGCAAAGCTGTTCCTGTACATAGTTGGCAGTGTATTGTCTCGTGTAGGCGATGAACCCATG
        ATCTGCGACCTTGACAACGGATCCCGTTCCCAGGTTGACATCCTGAAGCAGAACTTCTCCACGATGCCCAGTAGCTCACA
        GGGAACATTGAGGGCGATCTCCGCGAAACTTGCTGTGATCCTTGCCCGCGAGATGCTTTCAGCCAGCCCAGAAGGTGATC
        GGTGCCGAACGCTATTTAGCTCCACACTGCAGTGGTCATGTCCCGACATTTCAACCATTAAGGCGGTAGTGCAACTGGCC
        TGGGCCTCGTCTTGCGGAAATCTTCAGGCTCTAGGCAATAGTAGCGGCGACTTTGAAGACGAGGTGATCGTGCCGGACGG
        GCAAGACTTTAGCATGTGCAAGGAGGCGCTAGAGGTTCTCACCATTTCGTTTATTCTGAATCCGAGTGCCAACGAGGCGT
        TGACTAGCGATCCGAACTGGCCAAAGTTCATCACCTCCATTGTTCTGAAGAACCCGCTTCGCCACGTGCGTCAGGTGGCC
        TCTGAGCAGTTGTTTTTGGCTTCTACCTATTGCGCTGGGGATCGGCGACCGTTCGTATACATGGTTAACTTGCTGGTTGG
        CGCGTTGAAGACGCTGGTTCCCCAGTACGAGTCAACTTGCGCTGAGTTCTTCTCGGTGCTGTGTCGGACCCTTTCTTATG
        GATGCATCTACAACTGGCCGCTGCAGATTAGCGAGGGATTGTTAGGCGATGAGATTAAGTGGCTGCAACGCATTCGCGAA
        AACGTCCACGCCACCGGCGACACACAAGTGCATGAGGAGCTCCTTGAAGGCCACCTCTGCCTTGCCAAAGAGCTAATGTT
        TTTCCTTGGCGCCGATTCAAAGGCGCAGCTGAACGAGCTCATCCACGAACTGATCGACGACTTCCTGTTCACGGCCTCTC
        GCGAATTTCTGCATTTACGGCGTCATGGCAGTCTACGGCAGGACACCGTCCCGCCACCAGTTTGTCGCAGTCCGCACACA
        ATCGCCGCTGCTTGCGATCTCCTCATTGCCTTGTGCCAGCTCTGTGTTCCTAATATGAAGCTACTCACCAATACACTTAT
        AGACTTCGTCTGCACGGATACTGATCCGTTGCGCGAATGGGATTACCTGCCGCCGGTGGGCGCCAGGCCAACTAAAGGTT
        TCTGCGGACTAAAGAACGCAGGTGCCACTTGCTACATGAATTCGGTGTTGCAGCAGCTTTACATGGTACCAGCGGTCCGG
        GTGGGTATTCTGCGAGCCCACGGCGCTGCCACCACCGACGGCGAGGATTTCAGTGGCGATTCCGATTTGACGGGAGGCGG
        TCTTGGATCGGCCCTATTCTCGGGTCCCGCTTCTGCCCTAGTCAGCCTCCCCTCGTCGTCGTCAACTATCGAAGACGGTT
        TGCACGATGTGCGAAAGAACTATCACGTTGTGATCCTGAAACATGTGCAGGCCATATTCGCCCACCTGGGCCACAGTGCG
        TTGCAGTATTACGTTCCACGTGGTCTCTGGACACATTTTAAGCTACTGGGAGAGCCCGTGAATCTTCGCGAGCAGCAGGA
        TGCCGTGGAGTTCTTCATGTCCTTGCTTGAAAGTCTCGATGAAGGACTTAAGGCGCTAGGCCAGCCACAGCTTATGAATG
        CCACTCTGGGCGGTTCGTTCAGCGACCAGAAAATCTGCCAAGAGTGTCCCCATCGCTACTCCAAAGAGGAACCATTTAGT
        GTATTTAGTGTCGATATTAGGAATCATAGCTCATTAACCGAATCTCTGGAGCAGTATGTCAAGGGAGAGCTGCTCGAGGG
        AGCCGATGCATACCATTGTGATAAATGTGATAAAAAAGTAGTTACCGTTAAGCGAGTGTGCGTTAAGAAGCTGCCACCCG
        TGTTAGCCATTCAACTAAAGCGTTTCGAATACGACTACGAACGCGTCTGTGCGATTAAATTTAATGATTATTTTGAATTT
        CCACGTATCTTGGATATGGAACCATACACAGTGTCTGGCCTAGCTAAGCTAGAGGGCGAGGTGGTGGAAGTGGGTGATAA
        TTGTCAAACAAACGTTGAGACGACGAAGTACGAACTGACCGGCATTGTGGTGCACAGCGGACAGGCTTCCGGCGGTCACT
        ACTTCAGTTACATACTCTCCAAAAACCCAGCAAACGGCAAGTGTCAGTGGTATAAGTTTGACGACGGCGAAGTCACCGAG
        TGCAAGATGCACGAGGACGAGGAAATGAAGGCGGAGTGCTTTGGCGGCGAGTACATGGGCGAAACCTACGACAACAATCT
        TAAGCGCATGCAGTACCGTCGACAGAAGCGCTGGTGGAATGCCTACATGTTGTTCTACACCCGCTGTGATCAAACTCCCG
        TGCAGTATGAACCCAGCGTGGAGCAGTTGTCACTCGCAGAAAGTCGAAACATGGTTTTACCATTGCCAAAGCCCATTGAG
        CGCAGCGTGCGACACCAGAACATTCGGTTTCTCCACTCCCGCAGCATTTTTTCCGTGGAGTTCTTTAACTTTATCAAAAA
        GTTGGTCAGCTGCAATCTACTTTCTGCTCGGAGCAATAAGATCACTCCTGCTGCAGAAGAGCTTTCACTGCTGGGCGTCC
        AATTAGCATCGCAGTTTCTTTTCCACACCGGCTTCCGCACGAAAAAGTCTCTGCGAGGCCCCGTTATGGAATGGTATGAC
        GCGCTCTCACACCACATACGTTCCTCGGCACTAGTTCGCAAGTGGTTCGCTAATCATGCGCTCCTCTCGCCGCCATCGCG
        TTTAGGCGAGTACATTCTGATGGCTCCGTCTCCGGATGTCCGTACTGTCTTTGTCAAGTTGGTGGTTTTTTTCTGCCATT
        TTGCCATCAACGATGAACCTCTGACTGGCTATGACGGCGCTAATCTCTGCGAGCAGGTACTCATCAGCGTGTTGCGCCTC
        TTGAAATCCGAGGCAGCCGACTATGGCAAACACCTGCCCCACTATTTTAGCCTTTTCAGTATGTACGTGGGACTAGGAAC
        ACGGGAAAAACAGCAACTGCTTAGGCTCAATGTGCCGCTGCAGTTTATTCAGGTGGCGTTGGATGATGGCCCCGGTCCGG
        CAATAAAATACCAGTATCCAGAGTTCAGCAAGCTACACCAAGTGGTTTCGCACCTAATACGCTGCAGCGATGTAAGCGAA
        AAATGCCAGAGCTCCAACCAGAACGCCCGTCCACTGTCCAATCCGTTCAAAGATCCCAATGTTGCGCACGAGGAGCTGAC
        GCCCCTGTCCACTGAGTGCATGGACCTGCTCTTTAACCGCACGGGCTACATCAAGAAAGTGATCGAAGACACTAACGTGG
        GCGACGAGGGTCTGAAGCTGTTGCAATACTGCAGCTGGGAGAATCCACATTTCTCTCGCGCAGTGCTAACCGAATTGTTG
        TGGCAGTGTGGGTTCGCCTATTGTCACGACATGCGTCACCACACTGATCTGCTTCTGAACATCCTGCTGATCGACGACTC
        GTGGCAGCACCATCGCATACACAATGCTCTCAACGGAGTGGCGGAGGAACGTGAGGGTCTGTTAGAGACGATACAGCGGG
        CGAAGACGCACTACCAGAAGAGGGCGTACCAAATAATCAAGTGCCTGACGCAACTTTTCCATAAGTCGCCGATTGCGCTG
        CAGATGCTCCACACAAATTCGAACATTACTCGGCACTGGAGCATTGCAGTGGAGTGGCTGCAAGGCGAACTAGATCGGCA
        GCGGGGCATCGGTTGCCAGTACAATTCATACTCGTGGTCGCCGCCGGCGCAGAGTAACGACAACACTAATGGCTACATGC
        TAGAGCGATCGCAGTCTGCTAAAAACACGTGGTCCATGGCCTTCGAGCTCTGTCCAGATGAGGATGAAAATAATGAGCCG
        AACTTGGAGACGAACATGGATGAGAACAAATCGGAACCGGTGGCTCAGCCAGGAGGAGTGCTTGAGGGATCTACCGGCGG
        CACAGAGCAGTTGCCCGAAAATAAGACGCCAACCACAAGCAGCCCGTCGACTGCCGCCTGGCCAGCGCGTGGGGATAGCA
        ACGCTATTCCACGACTTTCGCGTCAGCTATTTGGGGCTTACACTTCGACTGGCAGTGGCTCCACTAGTGGAGGTTCCGCG
        CCAACTTCCGCCTTGACGACAACGGCGGGTAGTGGGGCTAACAGCGAAACAGAAAGCAGCGCCCAGGAAACAACCGGCGA
        GACGACCATTAACGGACTGACAAACAGCCTGGACCAAATGGAGATAACGGCCAAAAAGAAGTGCCGCAGGGTGATAATAA
        AAAAGCTAGTGGAAAGTAAGGACGAAGAGGACGCAACTACTGCTACCACAGCGGCCACCACAGAGGTCACAACATCGCCA
        GCGACAGCTATCGCAACGGCAGCAACTTTAGAGCCTGCCGGAATGAGTGAGCTCACGACGATGGTAGAGAAAAATCTTAT
        AATAAGCCAAGAAAATCCACAAGCGAAAAGCTCATTGCAATAAAATGTATTCGCAACCTAGCTGGAGGAGAAGATGATGA
        GTATCCATAGTGTTAAATGTAACCAAAGCAGCCTGACAATGAGAACGGTGTGGACAGGTGTTTACTAGTGGGGATCCCCA
        CCGTCGAAAACGAGACTTAATGGGTAAATACGAGAAAAAGAGCAGAATCCGTAGATATTAACAAAGGATACTTGGTTGGA
        GCGATGCGAGTCAAGGAACGAAAGTCTGGTAGATAAGGAGATCAAAACCAGCAAAGGTGTTTATTAGCTATCGAACTTTA
        TAATTACCTTTAATAATAAACAAATACACCAATTTTTTGTTTGGTTTTCTGTTTTGTTAAGCATTAAAAGGGATATGTTT
        ATTTCTCCTCATTGTAAATGTGTCCCTTTTAATGTATAAATCT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0085843
        9194
        FBtr0085844
        8682
        FBtr0307548
        9411
        FBtr0307550
        9837
        FBtr0339188
        9179
        FBtr0339189
        9379
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0300199
        2773
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0085202
        2778
        FBpp0085203
        2711
        FBpp0300200
        2761
        FBpp0300202
        2773
        FBpp0308326
        2773
        FBpp0308327
        2761
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        faf-RD
        Secondary FlyBase IDs
          References (0)