Open Close
General Information
Symbol
Dmel\Tomosyn-RJ
Species
D. melanogaster
Annotation Symbol
CG17762-RJ
FlyBase ID
FBtr0307900
Feature type
Associated gene
Evidence Rank
Length (nt)
4687
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 40 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GCCCAGTCGTCGAAGTTTTCACAGCTCTAACAGTTGAGACAACATTTTGAGAAATTGTCGTTTGTTTTGTCGTGCTTTTT
          GTTTAAACATTGCGTTGTGTTTTTTGTTTATCGCCCCCGTGTCGATCTGATCTGATTCGGTTCGCCAATCCAATTGGATT
          GGGCAAGCGCCACAAACGTTCAACAGCGGAGTGAATCGCCATGAAACAGTGAAGAAGCTGCAGGAGGAGCATAAGATGAA
          GATGTAGCTAACATCAAATATTTCGACCACTGTTAACCTAGTTTCACATCTCAAAAATAAAACCAAACAACAAGGACGAA
          CTCAGACCAGCACTGGCTCCTCTGTCTTCAATTACGCACAGCTCTACCAGTATCTAGAGAATAACGAGTAAAGGCTACCA
          AGGACTCGAGGGAAGAGAATCGCCTGGGGCAGAGGAAGAAGCCAATCCCCATACTTTTCGGTTCTCCTCGGACCAGAATC
          ATCACCTCCCCCATCCCGACCCCGGCACTACCTTCCCGCTGAACCACATACACTCTGTCCACTATCCACTATTCGACACC
          ACCACACTCTGTGCATCCAACTATTTGGCCAACCATTAATCCTTGGGCGAGACCAGAGCAGCCCCATCGCATAACTGTGG
          ATAGCAGAGCAGCCGGAGCACGAGGACGACTCATGTTACAAAAATGAAAAAGTTCACATTCAAAGGAGTTCTAGATGGAT
          TTCGACAAAGCGTTCAGCCCCAAGCCACACGACAGGAGCAGGAGATTCAGGAGCAACTCAAGGCCGATCACTTTACGTTA
          AAGAAAACCTTTCGCCATGGCTTTCCATACTCGCCCACATCCTTCGCCTTCGATCCAGTACAAAAGCTACTAGCGATTGG
          CGACAAATCGGGCTACATTCGCATTTTGGGACGACCTGGCGTCGATGCCCATGCCAAACACGAGGGCGAATCCGAGTGCG
          CCGTGCTCTTTGCCCAGTTCCTGGTCAACGAGGGCGCATTGGTCACCGTCACCGCCGATGACACCATTCACTTGTGGAGC
          ATTCGCCAAAAGACACCGCGCATTGTGCAGAGTCTGAAGTTTCAGAGGGAGCGCGTGACTTGCATACACCTGCCTGTGGG
          CAGCAAATGGCTGTACGTGGGCACCGAGAAGGGAAACATACACGTTGTTCACATAGATACATTTGCACTTAGTGGTTATA
          TTATTAACTGGAATAAAGCAATTGAAGTGGTTAGAACTAGTCATCCAGGTGCTGTGATTGCGTTATGTGATAATCCATTG
          GATGCAAACAAGTTGCTTATTGCATTTGAGTGCGGGCTGCTTGTGCTGTGGGATCTGAAGGCGAAATGCGCTGAGCTGCG
          ATGGCAGGCGGCCGAGGCCGTCAAGTCCCTGGCCTGGCACTACGAGGGCAAATATTTTGTGTCCTCGCACACGGATGGCT
          CCATTTGCTCCTGGCCCACGAAGCCGCAGGCTAAGCCGCAGTCGCAGGTCTGTCCGCATGCTAAAATCAACAAGGATGGC
          AATGCGGAGAAATGCAAGCCGATATATAAAGTTGACTTGAAGTCCAGCGCAACTGGGGAAACCTTCACAATTTTCTCGGG
          CGGCATGCCCTCGGAGAAGGGCTCCAAGTCCAACTGCATCACGGTGATGGTGGGCAAGGCCACCACGGTGCTGGAGATGG
          AGCACGCCGTTTGCGATTTCATAACACTCTGCGAGAATCCCTGGCCCTGCGAGACCCAGGAGCCGTATGCTATTGCCGTG
          CTGTTGCAATACGACTTAGTATTAATAGACTTATTAACACCCGGTTTTCCATGTTTTGAATCGCCTTATCCAATGGACTT
          ACACGAATCACCTGTTACATGTTGCACATATTTAACCGATTGCCCATCGGATTTGGTTCCTGCTTTCTATTCAGTTGGTC
          GCACAACGACAAGTAAAAAGAGCTGCTTCTCGGAGCGCGAATGGCCGATATCCGGTGGCGAGTGGTCGCCGGCGTCGTGC
          AGCTATTCGGAGATCGTGATCACCGGACACCAGGACGGCAGCCTCAAGTTCTGGGATTCCGGTGCCGGCACACTGCAGAT
          CCTCTATAAGCTGAAGACAGCCAAGATGTTCGAGAAGCCGCGCTCCCACGTCGCCCACTCGCATCCGGAAAGCGACAATC
          CGCTGGCGGTGCACCTAATCTTCCTTTGCTCGGAATCGCGACGCCTGTGTGTGGCCGGCGCCATGGGACAGGTGATGCTC
          TTCAAGTTCCGCAAAGTGGAGTCCACGTCGGAGGTACTGGTGCTGGAGATACCCATACTCTATGAGAATTTTGATGACAT
          TTATGGGACAAGTCCCGAGTGCGATTTTCTAACGGGCCATCAAGTGCAGAAGGCTGAGTCGAGTGATTCGGATAAGACGG
          CCGAGTGTTCGCTAAAGGTGCGCAATGGGGCGCAACGCAAGCCGCCGGGCTTCCAGTCGCAGCTGGTCTGCCTCACCACC
          GGACCAAATCGCCGGAACGTGCAGGTCACCTCGCTGTGCATCAGCTCCAGTTATGGCCTAATGGCTTATGGTACCGAATA
          TGGACTTGTCATAATTGATATAATCCAAAAAATTTGCCTATTGAGTGTTGCATGCCCCGATCTGTATGGCGCACATGATC
          CTTACTCGCGAACACCAAAAAGTCCAAAACGTATTGAAAACAAAGAGGAGCAAAGCCGATCGCCCAGCTCAGATCAGATC
          AACGGCAGCGGAGTTGCAACTGCAGCACCGCAGCAGCAACAGCAGCAGCAGCAACAGTTGCAGCAATCACAGCAACAACA
          GCAGCAGCAGCTACAGCAGCAACAGCAGCAGCAGCAACAACAACAGCAGCAGCAGCAACAACAACAACAATCGTTAGGTG
          GTGATCCTGGTGATCATGCAACATCGACGTCAGCGGGAGCAGCAACATTGGCGGGATCCTCCATTTACGGTGCAGATGAT
          GCAGATAAATTGGATGGAACTTTCTCAAGATCCAGATCATCGTCAATGTCCAGCATTGATATGTCTTCCTCTGAATCTGT
          TACCTGTTTAGCTTTTATCGAGAGTTATGCAAAACGAAATGATATTTTGACACTTGTTCCTACTTTGTGGATTGGAACTA
          GTTTCGGTTCGATACTGACATTGTTCATCACCATGCCCGAGCGAGATGTGCGCAAATCTCAGCCAGTATTGATAACAATA
          AATGGTGGCCCCGTGGTACGACTCAAAGGATCCATAACTTCCATGTCTTTTTTAGACTCATACGGTTCGATCATACCCTA
          TACGTTTGAGACCTGGCGTGACGAGAAGAGGGACAACAAAGATCGCACACCAACAAAGAGCAGCAGCCGCACCAGTCCCA
          CATTCACACCGACAACTGCCAATACATTATCAAACACTTCGGTCGCGGGTGGTGCGTCCGCAGGCGGAGGAGCTGGCGGC
          GGTGGTGGTGCCGGCGGTGGTGCGGCCAGCGGTGGCGCAGCCGCAGGAGGGCCAGCCGGCGGTGGTGCCGGAGCAGGATC
          GGCGGCTGGAGCGGCCGGCGGCGTTGGAAGCGGTGTAACCAGCGGCGGGGGGATGAGCAGCAGCAGCGCCAGCAGCAGCG
          GCATCAGCGGAAGTGTGAGCACCGGCCTGGAAACTCTCACCGATCGACAATACATCGTTATCGCAAGCGAGAAGCAAACA
          AAAGTCTTCGATGTCGCCAACCAGTGCTGCATCAACCGCATACAATTATCGGAAATGGATTTTGCAGTCAAGGCAGAAAC
          TATCACGATGAAAGATGGCTCTTGCTTAGCAACCTATCTTTCGAATGGCCATCTAATGGTACATAGTCTTCCTAGTCTAA
          AACTGTTATTGGATACTGATTTCTTACCACTTATGGAACTAAGTTTTCAAACAAAATGTAAACAGGGAATTGTGGATCCA
          ATGCTTTCGATATGGGGTCAACAGATCATTGTTCATGAAGATACAACTCAAATATCAAAAATATTTTGCTTTAGTCATAA
          AGGTCATGGATTGTACATGGCATCGCCCACCGAAATTCAAAAATTCACGATATCATCGGAATTTTGTCAATTTATTTTGG
          AGATGATGGGTGAACTATATACGGTACACGAAATGCCCGAACAGCCGAAGGAGGGTTTCTTCAAGGGTCTATTTGGTGGT
          GGCGCCAAACTCCTGGATCGCGAGGAGCTATTTGGCGAGCAGAGCGGGAAACCGAATCGATCGGTGGCACGGCACATACC
          CGGCCCCAATTTGGAGCAGCTCGGCCAGAGGGCTTCCACCGCCGCATCGGAGATCAGCCGGGCGCACCAGCTGGCCATGG
          AGCGCGGCGAGAAGCTAAATTTGCTGGAGGAGCGCGCCGAGCGCATGGCCAACACTGCTCAAGATTTCAGCGGCACTGCG
          CATCAATTAATGCTTAAATATAAAGACAAGAAGTGGTATCAGTTGTAAAATATCTATTTTAGGAGCCAATTCTACCACAG
          TTATTGTAATATTGCTTTTATAACACTTTCTACTACATTACGAGTAAAGTACACTTATTTAATTTCTGTTTTCAAGTCGT
          CACGTTATTTACAAAAACCGAAAACCAACAAAAAAAAACAACAAAAACCGAAAATTCACAAAAACAAAAAAACTGAAAGA
          GAAAACCCAACCAAAAAAAAACTGTTTTTAATAAAAATATATAGACC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0073678
          5490
          FBtr0300375
          5290
          FBtr0307898
          4541
          FBtr0307899
          5330
          FBtr0340406
          5041
          FBtr0340407
          5062
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0300334
          1254
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0073511
          1470
          FBpp0289604
          1470
          FBpp0300332
          1254
          FBpp0300333
          1470
          FBpp0309352
          1387
          FBpp0309353
          1387
          Comments

          Extended 3' UTR based on RNA-Seq and/or EST data.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          Tomosyn-RJ
          tomosyn-RJ
          Secondary FlyBase IDs
            References (0)