Open Close
General Information
Symbol
Dmel\CoRest-RI
Species
D. melanogaster
Annotation Symbol
CG42687-RI
FlyBase ID
FBtr0307902
Feature type
Associated gene
Evidence Rank
Length (nt)
3255
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 72 )
Sequence
TAGTTTGTGTATCCCTTGCAACCGTGGCTGCTACAGCCACAGTTTAAATTAATTTGAGCATTCGCTCAGTTTTCTGACGT
ATATTCTAGAAAAAGTGCTGAGAGTGTCCATCAAAAAGGGGCAAGCGAAGCCGTTTCTCGATCTCCAACGAAAACGGGGA
TAGGATAATCCAAGGGGCCGCCTGTCGAGAAGCCAGGCGAGGGCAAAAAATCGGATCAACCGACAGACAAAGCTGAACTG
CGGTCGTCGGCGACAAAGTGCGCTGTGCCCACGGACGACCAGAGAGAATCGGTACGCGAGTGAGTTTTTTTTTCCGCGTT
TCAGTTTGGATTTCAGTTACCTGCGCGCAACAACTCCACTGACCAGCCGTTCGCAGCGTTCCGTATCTGGAGTTTCTGGC
CAAGAGTACTCCTTTCCAAGTAGCCCCAGCTCCGCGTCCGGCAGGCCGTACTGCGTAAGCGGGCGAAAACGCTCCGCAGT
GCTCGTGTTCGCTAGTGCTCGTGTTTAGCCAAAACTAGCACCCTGGAGAAGCATAACAAGCGCGCCCAGCTCATCCGGGA
CAAGATGGTGTTGGCGGAGCGCAACACCACGGATGTGGTGCGCAACGGGCGCCGTTCGCGCGGCCCCAGTCCCAATACGC
ACACCACGGGCGGCGTCACCAACAGCGCCAGCCTCGTGGGCAGCGGCAACAACAGCGGCCACTCCGGGAACGCCAATGCG
AACGAGAAGACCACCACAGCTGTGCCAGGTGCAGGCACGCCGGAGAGCTCCGACGACGACAACTCCACCAAACGGAACGG
CAAGAGCAAGGCCAAGCAGTCTGAGTACGAAGAGAAAATCCGCGTTGGACGCGACTACCAGGCGGTTTGTCCGCCGCTCG
TTCCGGAAGCGGAGCGCCGCCCGGAACAAATGAACGAACGCGCCCTCCTCGTATGGTCGCCCACCAAGGAGATTCCTGAT
CTGAAATTGGAGGAGTACATTTCGGTGGCCAAGGAAAAGTACGGCTACAACGGCGAACAGGCATTGGGCATGCTGTTCTG
GCACAAACACGATCTGGAGCGTGCCGTAATGGACCTGGCCAACTTCACGCCCTTCCCGGACGAGTGGACCATCGAGGACA
AGGTGCTGTTCGAACAGGCCTTCCAGTTCCACGGGAAGAGCTTCCACCGCATCCGCCAGATGCTGCCAGACAAATCCATA
GCCAGTTTGGTCAAGTACTACTACTCGTGGAAGAAGACGCGTCACCGCAGCAGCGCCATGGATCGCCAAGAAAAGGCCAT
CAAGGCGGTGGTCAAGGATGGCTCCGAGAACGGCAGCGAGGTGGGCAGCAACGAGGAGTCTGATAACGATGACAAGAAAG
GGCATGGCACAAATAGCACCATAAATACCATCGACGCCACCACGACCTCAACCAACAACAGCACCACCAACTCCAACACC
ACCACCCCTGCAAATATCATTGCCAACACGATCAACAGCAACCATAGCAGCAGCAACAGCGGCGGCGGTGGCAACATCAA
CAACAACGGGGAGGAGAACATCCAGGCCGTCGGCGGGAGCAACACCATCAGCAACACGAGCAACAACGACATGGACGCCG
AGCAGTTGTCCCTCTTCGCCGGAAACGCCCAGATCGAGGAGATGATGGCACTCGGCCTAGCCGCTGATAGAGCCATCGGT
GCCAATGGCGGCAACAACAACAACAACGGCGAAATGGGGGGCGATCCTGGCCTGATGCGACGCATGGTGGTGGGCGGATT
TTGCAAGATTTGCAACGTGGTCTGCCATGTGCTGCACGACTCGCCGCTGGGGCGCATGTGCAAGAGCTGTCACACCCACT
GGAGGCGCACGGGCAATCGGCGACCCATTTCCGGGCCGGAGGGCAATGCTCCCCGAAGGTCCACACACAATTGCGCCGCC
ACTGCCGATCGATCCAAGCGCAAACCGCCCAAGGGCATGTACATCAACCACGATGACCTCACGGCCCTCGCAAGCTGCGG
GAATCCCAGTCTCTATTTGGCGGAACGCGAGCGGAAGCTAACAGCGCTCATGGCCGAAATACAGAAGAATAGGCAAGTAA
TGGAGCAGCTAGACAAGGAGTGCGAAACCATCAATGTGGATGATGTGCTTTCCAAGCCGGCGGCAGCCAACACCGAATCT
GCCCAGCCACGCATCTCTGCCCGTTGGCTGCCGGATGAGATCCAAGTGGCATTGCTCGCGATCCGCGAGTATGGAAAAAA
CTTTCCTACGATTGCCAAGGTGGTGGCCACCAAAACGGAGGCGCACGTGCGCACCTTTTACTTAAACAATCGGCGCCGCT
ACAATCTCGACCAGATCGTAAAGGAGTACGAGGCTGGCAAGTCCGAGGAGTCGGGCGCAGAGGAGCAGACCGAGCCTGCT
GTCGACGCAGCCGCGGCTGGCGCCGCAACAGCATCTGCGCCCAGCGCGGCTGATTCTACATCCGCCGCGAGCGCGACAGC
AGACAGGAAACAGTCCACCGAAAACAGCAACAACGGAGTTGAGACCATGCAGGAATCGTTGCCCAAGAAGGAGGACCCTA
AGAAGCCGGAGCTGGCAGCGGCTGTGCTCAAGATTGGCGTGGCCGAGGCAGCAGATGCCGTGGCCACTGTGGCATCCAGC
ACAGCCTCTGGCGTCATCGGTGCCGCCACCTCCGCCAGCAAGCCCAGCACCAGTGCTACAATCACCATTATAGATGAGTC
TGACACGGCCACGAACTCGAGCAGCGACGTTGTCACCACTGGACTTGCCACATCCACCGGCTCGTCCGCACTGTCCAGCA
CAACTAGTGCGCCCGCATCCAAAACGCAGACCAGCAGCGAGGAGTTGTCCGCTCAGAAATCCAATCCCGCGAGCGGGATC
GCAGCCATAGGTGCTGCAACGGGCGGTGGCCAGACTGCCAACAGCTCTGGCAGCAAGCGGGATAGCTCTGTATTGCCCGT
CGCCGAGCAGCCGCCGGCGAAGAAAATCGCGCTCAGCACCGGAGGCGGAAGCAGCGTCGCAGAGTTCCTGGCCAACTGAG
GAGCGACGTGTTCACTCGCGATATATATGCACGCATAGATATATACCGATACATAACATAGATTGATGTTTTGGGGGACG
ACGTCCAAGAACTGTGCAGCCGGCCATGCGGTTGATCATCGGATTAGTTATTTTTTTTTTATTCTCTTAATTGTCTTTAA
ACTTGGGACGCATTTATCGTAAAAAAGAAAGCATCACGGCTTTATCTAGGCTTGT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0302860
1839
FBtr0302861
1800
FBtr0302859
2085
FBtr0302862
3290
FBtr0302864
3296
FBtr0302863
3998
FBtr0307901
3155
FBtr0307903
2203
FBtr0336667
1834
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0300336
824
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0292000
273
FBpp0292001
273
FBpp0291999
273
FBpp0292002
588
FBpp0292004
590
FBpp0292003
824
FBpp0300335
824
FBpp0300337
336
FBpp0307648
268
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
CoRest-RI
Secondary FlyBase IDs
    References (0)