Open Close
General Information
Symbol
Dmel\CoRest-RJ
Species
D. melanogaster
Annotation Symbol
CG42687-RJ
FlyBase ID
FBtr0307903
Feature type
Associated gene
Evidence Rank
Length (nt)
2203
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 17 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CACTTGGTCATGAGAAGTCGGTCAAACGTACATTCATAAGCAATTATCGCAGAATGGATGAGATTTTCAGTTTATATTGC
        ACAATACAGAAGAATAGGCAAGTAATGGAGCAGCTAGACAAGGAGTGCGAAACCATCAATGTGGATGATGTGCTTTCCAA
        GCCGGCGGCAGCCAACACCGAATCTGCCCAGCCACGCATCTCTGCCCGTTGGCTGCCGGATGAGATCCAAGTGGCATTGC
        TCGCGATCCGCGAGTATGGAAAAAACTTTCCTACGATTGCCAAGGTGGTGGCCACCAAAACGGAGGCGCACGTGCGCACC
        TTTTACTTAAACAATCGGCGCCGCTACAATCTCGACCAGATCGTAAAGGAGTACGAGGCTGGCAAGTCCGAGGAGTCGGG
        CGCAGAGGAGCAGACCGAGCCTGCTGTCGACGCAGCCGCGGCTGGCGCCGCAACAGCATCTGCGCCCAGCGCGGCTGATT
        CTACATCCGCCGCGAGCGCGACAGCAGACAGGAAACAGTCCACCGAAAACAGCAACAACGGAGTTGAGACCATGCAGGAA
        TCGTTGCCCAAGAAGGAGGACCCTAAGAAGCCGGAGCTGGCAGCGGCTGTGCTCAAGATTGGCGTGGCCGAGGCAGCAGA
        TGCCGTGGCCACTGTGGCATCCAGCACAGCCTCTGGCGTCATCGGTGCCGCCACCTCCGCCAGCAAGCCCAGCACCAGTG
        CTACAATCACCATTATAGATGAGTCTGACACGGCCACGAACTCGAGCAGCGACGTTGTCACCACTGGACTTGCCACATCC
        ACCGGCTCGTCCGCACTGTCCAGCACAACTAGTGCGCCCGCATCCAAAACGCAGACCAGCAGCGAGGAGTTGTCCGCTCA
        GAAATCCAATCCCGCGAGCGGGATCGCAGCCATAGGTGCTGCAACGGGCGGTGGCCAGACTGCCAACAGCTCTGGCAGCA
        AGCGGGATAGCTCTGTATTGCCCGTCGCCGAGCAGCCGCCGGCGAAGAAAATCGCGCTCAGCACCGGAGGCGGAAGCAGC
        GTCGCAGAGTTCCTGGCCAACTGAGGAGCGACGTGTTCACTCGCGATATATATGCACGCATAGATATATACCGATACATA
        ACATAGATTGATGTTTTGGGGGACGACGTCCAAGAACTGTGCAGCCGGCCATGCGGTTGATCATCGGATTAGTTATTTTT
        TTTTTATTCTCTTAATTGTCTTTAAACTTGGGACGCATTTATCGTAAAAAAGAAAGCATCACGGCTTTATCTAGGCTTGT
        AGAGATTAGTTCGTTTGTATTTGAGGTAACCTTGAGACAGTTCGATTACACATAACACACCTCCACACACGACCCCGGGG
        ATCGTAAATACATAAGCTCTGCAACTCACGTACGTAATCTTTGAATCCGTCGTAGCACGAAGAAGGAGCTCCGCCGAGCT
        CCGCTGAGCACCGCTGATTTAGGAACGATGTATCTTTCACAACAATGTATAGGTCAGAGATATTTTAAATGGGTTTGACG
        GGTAGATACTGTCCTACGGCGGATCGGTGCCACGTAGACCACACAAAACTATGGATTAGTGCGCCCCAAAAGGGAAGAAG
        TCGTCGAAATTAGCGCAGTTTATGTATGTAAAACTATGATAAATGAGAAGAGGAGTTGTACGCGTGTAAATTAATAACCA
        AACTCATCATTTTTTTTTTTTTTTCGTGACATTACCTAGCATATAACAAGTAAGTGGGGTAGCCCTGCTGCCAACGCAGC
        TACCCCAGCTAATACAATCTGGAATATCACCCATCCGGCCTCACCACTTCGGCACTTCGGCAGGGAGTTTCTGTTAGGCC
        AGCAGCATGGCATGGTTATGGTGTAGCCAACACCTGGCCACCATTGTAAACATACAAGCAAGCTAGCAAGCGGTATCCAC
        ATTGGAAAACAGTCTATAATGTAATAGGAGGATGCATGTTGTGGCAGACGAAACTCAATCTATACTAAAACCGAAACCGA
        AACCGAAAACGGAAACCTAAACCGAAAACGGAAACCTAAACCTAAAACCTAGTATCCTAAGTATATACACTGGCCTATGA
        AACTCGATTTCTCTGTTCTTAGTAAAAGAGGTCTAAATAAGAAGTTTGTACATCTCGGATTCGGATTCGACTTGAATGAG
        TCGCTGTCCAACGAGTTGTTAACAATAAATATACGATAAATAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0302860
        1839
        FBtr0302861
        1800
        FBtr0302859
        2085
        FBtr0302862
        3290
        FBtr0302864
        3296
        FBtr0302863
        3998
        FBtr0307901
        3155
        FBtr0307902
        3255
        FBtr0336667
        1834
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0300337
        336
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0292000
        273
        FBpp0292001
        273
        FBpp0291999
        273
        FBpp0292002
        588
        FBpp0292004
        590
        FBpp0292003
        824
        FBpp0300335
        824
        FBpp0300336
        824
        FBpp0307648
        268
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        Based on cDNA(s) that contain premature stop codon and/or downstream start; may or may not produce functional polypeptide.

        Transcriptional initiation is supported by short-capped RNA data (FBrf0209722) and RAMPAGE TSS data (FBrf0220331).

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CoRest-RJ
        Secondary FlyBase IDs
          References (0)