Open Close
General Information
Symbol
Dmel\sd-RP
Species
D. melanogaster
Annotation Symbol
CG8544-RP
FlyBase ID
FBtr0308134
Feature type
Associated gene
Evidence Rank
Length (nt)
3355
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 33 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TTCAGTTTCGAAAAATTTTTCGATGGAAGCAGCCGAGTGCGAATGCGAATGCTCAATGAGAAGAGCTTTTACTGTTTTAC
        TTTTTGCCTGAAATACATTTTGAGATAATTTCTTATTGTGCATTTATTAAGGAATCCGTCTGATATCAGAACAACCTTAA
        CTAACGCCTTTAAATCAATGATATGGTGGCCAATTCCCATTCCGTCGAACAATCGAATCGAGCGACTAGATTCGGTAAAC
        ATCGACCAAGTGTAAACTCGACTCCCATTACCACTGTGTAAATACCAGAAAGTAAATCCAAAAAAAAGAACAATAATTCA
        ACCTGCAGGGGAAACTAAAAACGCACGATACACTTATTTGGAAGTGGATTTAAGTTTCAGTAATGCCAGCCAATGAACGA
        CCAATTGCGATACAATACAGAAACACAAACAGAAACCGAAACATAAGCGAAGAGTAAATAAATGCAAATTAAAACAAAAA
        AGCCGGGCTCATGACACAATTGGTCATGTAAATCGCGAAAGATAAACATAATCCGTATAATTCGTATAAATATCATCGTA
        GTCGCGACGGTGGAAAATGTGCAGTGCGGTTAAATCCTAAAAAATGGATCGGTTTTCACTGATAAGCATCCGCATTTGGG
        TTTATTTCTTCGATCCCTGCAAGGTCCGCGAAAAAAGTTCGCCGAAGAAGGTGCTGTGAATAGCCCAATCAATCCGCACA
        GCTCTCCATTTCGAGATAGAGATCTTCTCCAGCTTTCGGAATCCTCGCACATCTAGACCATATCCTAGCCAATCGGAGCA
        GCCGCGCAATAAGTAGCATCTAATCCTGGAGCTTTACACCAATGCGATATGGATTGTGATTACTCGAAGTTTCTGTACAA
        AATTGGACCCGGCACCATACCATCACCGTGGACACCAGTGAATGCCGGTCCTCCAGGCGCACTTGGATCGGCAGACACAA
        ATGGCAGCATGGTGGATAGCAAAAACCTGGATGTCGGTGATATGAGCGATGACGAAAAGGACTTGTCATCCGCTGATGCC
        GAAGGTGTATGGAGTCCAGATATCGAGCAGAGCTTTCAAGAGGCTTTATCTATATATCCGCCGTGCGGACGTAGAAAAAT
        CATTTTATCCGACGAGGGTAAAATGTACGGTCGCAACGAGCTAATCGCACGATATATAAAACTGCGCACAGGCAAAACGA
        GAACCAGGAAGCAAGTCAGTTCGCACATCCAAGTGCTGGCTCGCCGTAAACTCCGCGAGATCCAGGCGAAAATCAAAGTG
        CAATTCTGGCAACCTGGACTACAGCCAAGCACGTCCCAAGACATCAAGCCCTTCCCCCAGCCGCCGTATCCAGCTGGCAA
        AACGTCGACTGCGGTTTCCGGGGACGAAACTGGAATTCCGCCCTCACAATTGCCCTGGGAAGGACGAGCCATTGCCACGC
        ACAAATTCCGCTTACTCGAGTTTACGGCGTTCATGGAAATCCAGAGAGATGAAATTTATCACCGGCATCTATTCGTTCAA
        CTTGGCGGCAAGCCATCCTTTTCCGATCCATTGCTTGAGACTGTTGATATACGGCAAATATTCGACAAGTTTCCGGAGAA
        ATCTGGGGGACTTAAAGATCTCTACGAAAAGGGTCCACAGAATGCGTTTTACCTAGTTAAATGCTGGGCGGACCTGAATA
        CCGATCTAACAACCGGCAGCGAAACGGGTGATTTCTATGGCGTAACCAGCCAATACGAAAGCAACGAGAATGTCGTGCTC
        GTGTGCTCCACAATCGTTTGCTCCTTTGGCAAGCAAGTGGTGGAGAAGGTGGAAAGCGAGTACTCTCGACTGGAGAACAA
        TCGCTACGTCTATCGCATTCAACGCTCCCCCATGTGCGAGTACATGATCAACTTTATTCAGAAGCTGAAGAACCTACCGG
        AACGCTATATGATGAACAGTGTGCTGGAAAACTTTACAATATTGCAAGTAATGAGGGCCCGCGAGACGCAGGAGACACTG
        TTGTGCATAGCCTATGTGTTTGAGGTGGCGGCCCAGAACAGCGGCACCACCCATCACATATACCGTCTAATTAAGGAATA
        GCAAAAGCTGCATGGAGCAGAACCCAACCTGTCTGCGAATCCCATCATCAACACACAAGTTCACAAATATACCGACAACA
        ACAACAGCAGCAGCATCAACAATAATAGTATCATCAATACGGCTAAGAATTGCGATAATAAGACGAGTAATGAAATTGCC
        AACACAATATCCAACACCAAGAGTGCCAGAATCATCAGCAGTATCAACAGTATCAACAGCATCAGCAACACCAGCAACAT
        CGGCAACATCAGCAACATCAGCAACATCGGCAGCAGCAATAGCAACACTATCGCACTAAAATGTGGCGACGGCAATATGA
        AAACCAGGAACCTATCCGTTGCTGGCGCCACAATTATCAAGCAATCACTCACCTCACCGCAACATCATACGGATATCGAT
        GCCTTGACAGCACTTCAAGTGGAGGAGGTTATTTATACACAGTCACAAGGGAATACCAGTTATCAATTAGACACCGAAAC
        AAGCATTGCTCCCAACGTACAAGAGCCAACACTCCAGCAGCAACATACCGCCTATGAGGATCGTACAGTGACAGTCCTGC
        CACCGTATAATCTATGTATCGGCAACAAGCAACCACAACCATTCGAGGCTGAGCAACACGAACACGAACACGACCAGGAA
        CAGGAACTGGAACTGGAACTGGATCAGGAACAGCAGAAGCAACTGGGGAACACGGGCTATGAGCAGTTCCTGAAGTTGTC
        CGCTCATGAATATTCAGAAACTGACAGACGCTCCGCGGCTGCTCTAAATCTCAGCAGTATTGGCGAAAAAGAAGCGGCAT
        TGGTCGGTGAATCCAAGACGGATCTTGAAGATCCGCCAGAGTTTCGGATGCTTCGAGAGGTCAGTGCGACAGCGGCGGAG
        GATCCACGACGAGGACCCAACGCCGATGGAATCAGTAACAAAGGCCGTGAGCCGTGAGCGCCATATAATACCACCAGCCT
        TTAAGCAAGGTTGAGGCTTATTTTAAGGGTTAGAAATACGATTGCAAGGAACGACACAATCAGAGCTTTTTGTTTTCCAC
        CCAAAACGAGAAAGAAAAAAAATGAAAAAAAAAACCACATGGCAGGGGACAATGGAAGAGCCTCAAAACAAGAGATGATT
        GATTGGTGTTCAGTATCGAAATCAGATTTTTATTTGTGCAAAATAAAAAATGTATCATATTTTATGTTACAATCATTTGA
        AAGACTCAAAAAACAACCGACTTTAGTTCAGCATAGAGTGCTTTCTGTAAAATTGTACTATAATACATAAAAAAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0074100
        2677
        FBtr0074099
        3194
        FBtr0074101
        2841
        FBtr0112824
        3288
        FBtr0112825
        3252
        FBtr0112826
        3047
        FBtr0112827
        3139
        FBtr0301543
        3237
        FBtr0301544
        3280
        FBtr0308128
        4045
        FBtr0308129
        3113
        FBtr0308130
        2527
        FBtr0308131
        5331
        FBtr0308132
        3471
        FBtr0308133
        3781
        FBtr0310311
        3670
        FBtr0310312
        3076
        FBtr0310313
        3164
        FBtr0340115
        2666
        FBtr0346799
        6005
        FBtr0479844
        5331
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0300456
        410
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0073915
        370
        FBpp0073914
        440
        FBpp0089157
        370
        FBpp0111736
        410
        FBpp0111737
        440
        FBpp0111738
        440
        FBpp0111739
        440
        FBpp0290758
        435
        FBpp0290759
        435
        FBpp0300450
        410
        FBpp0300451
        440
        FBpp0300452
        370
        FBpp0300453
        435
        FBpp0300454
        370
        FBpp0300455
        410
        FBpp0301994
        625
        FBpp0301995
        440
        FBpp0301996
        440
        FBpp0309110
        375
        FBpp0312377
        410
        FBpp0428180
        747
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        sd-RP
        Secondary FlyBase IDs
          References (0)