Open Close
General Information
Symbol
Dmel\NPFR-RD
Species
D. melanogaster
Annotation Symbol
CG1147-RD
FlyBase ID
FBtr0308318
Feature type
Associated gene
Evidence Rank
Length (nt)
2502
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 4 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          ACGCAACGCGCCCCGGCAAACAGCAAATCAGGCGGATATATCGGCGGGACTAGGGTATATAAGCAGGAGATGCGCACCAA
          AAGCCAACAGATGGTCGCTGACTGTGCACGCGTGTGGTTATCGGAGATCAGTAAACAGCCCAACTAAACACCGAAACTTA
          CTGTAATAAAAAAAAACGGGAAATAAGCGAAATAATCAAAATGCGGCCGCATACTTATTTATAATTTTGAGGCGGCCGAG
          CACCGGGGCCCCAAACTCTTTGGATCTGCACGGAATCCAGAATTCCGAGAGAGCAAAAACACAAAGCGAAGTCCCGTGAG
          TGCATTCCAAGTTGAAAACTAAGTGAGCAACTGCTGCTTTGGCAGCCGGAAAAACAGAGATTCACTCGTGTCACTCGCAG
          AAGGAAAAACAAGAACCGACGGCCAGGAAAACAATACGGTACCACGCACTATAGTAAATATATAGCATACATATCCCCAG
          GGCGAAGGAGATTGCCAGGACGATGATAATCAGCATGAATCAGACGGAGCCCGCCCAGCTGGCAGATGGGGAGCATCTGA
          GTGGATACGCCAGCAGCAGCAACAGCGTGCGCTATCTGGACGACCGGCATCCGCTGGACTACCTTGACCTGGGCACGGTG
          CACGCCCTCAACACCACTGCCATCAACACCTCGGATCTGAATGAGACTGGGAGCAGGCCGCTGGACCCGGTGCTTATCGA
          TAGGTTCCTGAGCAACAGGGCGGTGGACAGCCCCTGGTACCACATGCTCATCAGCATGTACGGCGTGCTAATCGTCTTCG
          GCGCCCTAGGCAACACCCTGGTTGTTATAGCCGTCATCCGGAAGCCCATCATGCGCACTGCTCGCAATCTGTTCATCCTC
          AACCTGGCCATATCGGACCTACTTTTATGCCTAGTCACCATGCCGCTGACCTTGATGGAGATCCTGTCCAAGTACTGGCC
          CTACGGCTCCTGCTCCATCCTGTGCAAAACGATTGCCATGCTGCAGGCACTTTGTATTTTCGTGTCGACAATATCCATAA
          CGGCCATTGCCTTCGACAGATATCAGGTGATCGTGTACCCCACGCGGGACAGCCTGCAGTTCGTGGGCGCGGTGACGATC
          CTGGCGGGGATCTGGGCACTGGCACTGCTGCTGGCCTCGCCGCTGTTCGTCTACAAGGAGCTGATCAACACAGACACGCC
          GGCACTCCTGCAGCAGATCGGCCTGCAGGACACGATCCCGTACTGCATTGAGGACTGGCCAAGTCGCAACGGGCGCTTCT
          ACTACTCGATCTTCTCGCTGTGCGTACAATACCTGGTGCCCATCCTGATCGTCTCGGTGGCATACTTCGGGATCTACAAC
          AAGCTGAAGAGCCGCATCACCGTGGTGGCTGTGCAGGCGTCCTCCGCTCAGCGGAAGGTGGAGCGGGGGCGGCGGATGAA
          GCGCACCAACTGCCTACTGATCAGCATCGCCATCATCTTTGGCGTTTCTTGGCTGCCGCTGAACTTTTTCAACCTGTACG
          CGGACATGGAGCGCTCGCCGGTCACTCAGAGCATGCTAGTCCGCTACGCCATCTGCCACATGATCGGCATGAGCTCCGCC
          TGCTCCAACCCGTTGCTCTACGGCTGGCTCAACGACAACTTCCGTAAAGAATTTCAAGAACTGCTCTGCCGTTGCTCAGA
          CACTAATGTTGCTCTTAACGGTCACACGACAGGCTGCAACGTCCAGGCGGCGGCGCGCAGGCGTCGCAAGTTGGGCGCCG
          AACTCTCCAAAGGCGAACTCAAGCTGCTGGGGCCAGGCGGCGCCCAGAGCGGTACCGCCGGCGGGGAAGGCGGTCTGGCG
          GCCACCGACTTCATGACCGGCCACCACGAGGGCGGACTGCGCAGCGCCATAACCGAGTCGGTGGCCCTCACGGACCACAA
          CCCCGTGCCCTCGGAGGTCACCAAGCTGATGCCGCGTTTGGAACAGTACTAAATTGGCAATCAATCCTGGAGCAGCAGGC
          GGCTGGAGCAGCATTCTAGGGAGGCGACTGCCTGTCACCCATAGACTTAACACGTATTGTCCAGTGATCCAAAGCCAAGC
          TGAGTTAGCCCTAAGTTAAGACACACGCGACTAAGAGCTCGAAGCCTGTAAACTATTCTTAAACGACCATGTCATGGCAT
          CCATCATCAACTCGGACTAAGTCTATGGTTAGATCACTTTCGTATCAAATGCCGAAAAGTAATTGAATGAGCCCCCAATT
          AGATTTCGGGTATTTGATAAGTCGAATACGCCTAAGACTCGAATAAGTTCTCTCAACAGTTCCTAGGAAATATTTTCGTT
          TTATCTCAGCATTTCTTGGTATCATCTAAGCTAAGGATTAGCTATAATTGATGTTCTGTTCGCTATTCAATAATGATAGG
          ATAGGTCGAAGTCCACTAAGCCAAAGTGAATTTAAAGTATAGTATAGTATAAAGTATAATTGTAAAAGATAACTTTAAAA
          TAAATGTCAGCTGCTCTTAAAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0078590
          3214
          FBtr0308316
          2433
          FBtr0308317
          2465
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0300637
          489
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0078239
          485
          FBpp0300635
          466
          FBpp0300636
          462
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          NPFR-RD
          NPFR1-RD
          Secondary FlyBase IDs
            References (0)