Open Close
General Information
Symbol
Dmel\CG2765-RD
Species
D. melanogaster
Annotation Symbol
CG2765-RD
FlyBase ID
FBtr0308686
Feature type
Associated gene
Evidence Rank
Length (nt)
2648
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 28 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ATCAGTGCGCTCGGCGCTCGCTCTGTCAACTAGCTGCGATCACGCGGCCCCGAACTGGCTGCCCACATGCCGATCCGCCC
        CGAGCAATCTGGCCGCATTAAATAGGAGGTGCGGGAGATACGCAACTTCAGCTCTGTCTGGGAACTGTCTAGCGACGATA
        AGCCAAGCCGCCTCTAGACTTTGGCCGCTCCAGCTCCAGATATCAGCAACTAACATATATTCCCGGCGGGTTAATGGAGG
        GAGCTCAGGCAAGTTTATGGGGCTTGACCTGGAGATGTTACGCGATCTTTTCGTGAAATTAAAGTTAATGCGACCAGCCA
        GGATTGTATAACCATTACATTGAAGCTTGCGAGCAAAGTCGGGCTTTACCCTCGCACCCCGCCACCGACAGCACGTGGAC
        GCGTTAAATTGGCTTTGGAAACCAAAATAGAAATCTTTCTGTCCGTCCGTCTGTGCTTTGTTTTAAGAGCCACACGAGCA
        ATGTCAGGTATAAAGCACCAACTGGTTTTCTATTTTATACAAATTGAATTTGCGACAACGCCAGCGAGTCGCTGATTTGC
        ATAGAAACCAATTCATATATATCATATGCCACGTTGGTCAGCAGGAGGCGCACCCATCTCCAGTCGAAAGCATCAAAGAA
        AGATGGCTTCGAGTGGCGGAAGTCTGATCGCCGCAGACTTAACGACGCTTTAGAACGGCCAGCGCTTGGTCCAGTCTGGC
        GTGATGTGGCATAGTCACTAATCACGCAGACTATTGTCCAATCCAAACTGGTTCCCCTGCACACGCTCTACTGGTTTATT
        GTGCTCTGGCCCAAGCTCATCTTTCGATTGTTCTGTTTTTCAGAAACTGCCTGCGCCGCATCGCCCGTCACGATGAGCAG
        CAGTTCTCCAAAGACAGCATTGTCAATGTGATGGAAAAGTTTGTAAAGACTGTCAACATTATGGACGACACCATACTGGT
        GCCATGCAGGCTCATGGATCGGCAGATCGGCGACAGCACTGACATCATCCCAGCAACCGGCAAGGACTCGACCGCCAACC
        AGCTGACACAGACCTCCAGTGCCCACGGCAAGCGGGGAGCGGCGCATTCAAAAAATGTCCAAGACTTTCTCAGCGCCTCC
        GAGCTGTTCAATCTGTACAACATGCTGAACTCCCTGAAAAAAGATCTGCTTTGGACCGCCAACCAGGAGGACGACGACCA
        GCAGCACTCCGAACAGCAGCTCAACGCCAGTACCAGTTCCACTTCGAGCTGCAATCCCAGCGAGAGCAAGACTGAATTCA
        ACAGCGGCAGTCCAAGCACAACCGCATCCGGAAGTGTCAAGGGTCATGTGCGCCGTACCTCTACCGCATCCATGATGTCC
        ACCAACTCGGTGAGCAACATGAGTGACTCTGACTCGGACATATCGCAGGAAAACGACTCGGGGCTAGAGTCCGATGGCAA
        CAAGAGCGACAACGCCCAAAGCAGCGACGGCAGCGACATTGTAGACGTCGCCAAATCGAAGCCGGGCTCGGGGGACAAGG
        CCACGGAGCTGGCCAAGCGCTGCCGGAGGCATCTTAACGGTCTGTACCAGTGCCTGGAACAAATGACAGAGGCGGCCAAC
        TACCTGACCGCCAGATACCAAAGTGATATTGGGCCCGTCTAGGACCGCCAACTCAAGGCCTTCTCGACCCTCTATTTCCT
        ATGCCTCCTACACTATCACTTTCTTTCGAGCTGGTCGGGGTTAACTTCATACCATAGTCGCGGGCGGGTCTTTACACTCA
        TTATTATCAAGTGTGAGGTATTTTTTTAACTTTAACTATAACTGTATCAAAATATCTATATCTATGTATGTATATGATTA
        TGTATATGTATCTTGAGGGGGTGCTAAGCAAGACATATGAGAATCGTATGTGTGCAATAGGATTGTATAAATGTATAACT
        GAGGATGATAAATAACTGGTAGATATAGTAGTGGATAAAGCAGCGCCTAAGCAACAAATTAACAAACGTTCTATTGTAAA
        AATTGTAACCTCTGCGTTGCATCTCTCTTATGGGTTTAAGGGTAGCCAAAGTCAAAAATCACAGAAGCGAGTCGCATCTA
        TCCCAATCATTCCTTCTGTACCCGTTGGGGCTCCATTGCGCCCAAGTCAACAAATAACCACCATGGCGCAGCGGTGGCAC
        CGGCCCGAATATCCCTCTTCTTTACAATTGATTTTCGTATTTATATATTGGATAGATAGCTATGGGAACTGCAAAACAAC
        ACTAAAGCAAACGATGTTCAACAAGTACAAGAAATCTAATTTCTAACTAAATTACGAATACGAACGTAAGTGAAGTGGGA
        GCTATGCTTGTGGAGACGGGACCACTTCACTTTTAGCCTGTATGCAAATTTATATATTCCACAATTGTTATTGTAATTGT
        TTAAGCCAACTATTTGTGCCGTTATGTTTCGTTTGATTTCCACTTCGCAGCCGACCAGGGACACCCAGTGGTTACAGCAG
        GGGGGATCTCCTAAATCCCACCAAAGGTGACCTGGATACCCGACTGTGAGTCCCTGGTTCGGCAACGAGGACTGCAGAGC
        GAACTGTAAATTACTAACGTTAATAGCGCTTGTGCGAGAGCTAAAAGAGAATTATTTATACATAATAAATAAATTTTACT
        TAGAAAAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0113118
        2053
        FBtr0113119
        2072
        FBtr0308687
        2310
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0300892
        243
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0112031
        243
        FBpp0112032
        243
        FBpp0300893
        243
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        Transcriptional initiation is supported by short-capped RNA data (FBrf0209722).

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG2765-RD
        Secondary FlyBase IDs
          References (0)