Open Close
General Information
Symbol
Dmel\lncRNA:CR31781-RE
Species
D. melanogaster
Annotation Symbol
CR31781-RE
FlyBase ID
FBtr0308926
Feature type
Associated gene
Evidence Rank
Length (nt)
2441
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 18 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GGCCAGTCGTCAGTCAGTTGGCCAACAAACTGGTAGCGTCTGGTGTGGCGAGCCAACAAAAGGCTGGCAGAGCGGCCAAC
          ACCGGACCCGGCCCGAAACTGAATCCGGGTCCGGGTCTGGGTCCGTGTCCGTGTCCGGGTTGGTTTCGCAGCATCTACGG
          CATCACGGCTGCCAATTGAGCGGAGTTTGGGTCTCAATTTGACGCGTAGCCAGCCAAGAAGAGTGGCCGGCCAACAACAA
          AAACAGGTGACGCAGGATGTGGCCAACTGAGTAGGGAGATGGCGGAAGAGCAGGAGGCGCAGGAGGAGGAGGAGGAGGAG
          GAGGAGGAGGAAACGCAGCACACTTTTTTGGCCACGGTCCGCGTTTGATTAGCCAACTCAAACATCAGGGCCAAGATCAG
          GGCAATTGACAGCTCTGCTCCCTCAGTTTCTGCTTCCGCTTGGCACACAGTCACAGAGACACACATTGCCTTATGGCCAC
          TGGACGATGGACCACAGTGGAGCCTGGGCAGTACGCAACACCTGACGCTGCCCGCCAGGATACTCCCGTTCGTCTCGATC
          ATACAGCAAATAAGAAACATTAAATAAACAATCAAAGAAACGGAGTATTGCTCCGCAACTGCCAACAACATTCAACGACA
          ACCAGTTGCTCTGTGGTGCTAGAAAGTGAGTGTAAACAGTGTGTGCCTTTGTGAACTGAACTGACCAACGTGCCAAGAAC
          GAAGGGACGAGGAGGTGGGCACTCTGGCTCGGACCCAAGCGATTTGGCAGGAGCTGATTGTTTCATCTGGCCAGGCTTAA
          TGAAATAACTCGTCCTGGCCGCGGCTCCATGTCAAACGCAGCAGGGCAATCGCCAGCGAAGCCCCAAAGGATAAGCATCG
          TCCAGAACATCGGAATCTCCAGCGAAGGATGCACCAAAAACATTATCCACAGGACTAAGATGCCAAAGGAAACTTTCAAG
          ATCCGTTTCCAAAACAAAACATAAAATATATTCAATAAAAATGAAGTGGAAATGAAATGATACATAATAAATACCCTAAT
          ACATAACAGAAACAAAAGCAAGTCACTAAACTTGACTGCAAATATAATACGATGACACTTAATAGAAACATTGTAATAAA
          ATTGAAAAGAAGTAGACAAGAATAACCACTCATAAAACTAAAATACCCAGCCTATAACTATTTTTCAAATAGTTGGCATA
          GTGCTTACTATGAACCATAATCGCATATGATATAACCAATATTGAGCACTTAATATAGCCCAATATTATATAGACCCAAA
          TATGAAATAGTCACAAACAATAGTGCAATACAATACGTTTATAAAACAACGTCAAAAGTTTTATAACGAAAATATATTTC
          TTTATAATGAGCACTTTCGAACAACTACATTTAATATAAAATAGCGCGGGAAGTCTTCGGCGTGGTGAAAGTATAAGGTG
          TAAGCACAGCTGAGAAGAAAGGAATTTACAAAATCGAAGGAAGAAGTGAAAGAAGGAGTGAAAAAACATCTAAGCGCGGA
          AAAGTGCTACAAAATGATTTTCACTTACATAAACCACATCAAAGCCATCACTCAATTGCCACTTTCAGTCATTTCGACCA
          TGTCCAAGAATGAATAATGGATGGGGAAAATAAAGAGAAGCTGACATCCTAAAGGAAACCTTGTTGGCCAATTGGGGAGG
          AGGCCCAGAAGGTCGGGCCGATTTTCCGCTGCAACCGACGAAGGTCTGACCAACCAATCGCAACGCACAGCGGCGACGAA
          GCCCGGCCGAATGGGAGCATCTCGGGCAAACGGAGGGACAGTCAGCCGCCCTGCAATGCATTTCTTTTGGCAACGAGTCA
          AGCGGCCTTTCACACACACACACACACACATTAGGATTCCATAAGGATACTCTGCCTCGCTCACATGCGCATCGAGTGGT
          ATACGTAATATATCAAGTATACGCCTGTTGGCCGGGCAGAAAGTCTGTGAGTGTGTGCGAATGGCCAAACAGAGTGTTGC
          CAACTGCATTGCCGGGCTGCCAACGACTCAACCCCCGACCCGAGGACACCACCCTCCTCCCGGCCAGGAGGCCAACGACG
          AGTCCTTTTTGGAGGCAGCGCATTGGCTGCAGGACGACCGGCGACAGGACGACCAATCACCAATCAAATCGCGGCTTGTG
          CGCACTATCACGGCCGTACGAAGGGCCAAAGGCACGGCATCCAGGACCTCAGCCGGAGACCCCAAGCCGATTGTCAATCT
          CTTAGACATATTATTATGCCAACGTCTCCTATATTATAGTTCTCTAGTCGTAAGTCACATGCCCAAGCCATCGCCCCAGA
          ACATCGGGGACATGAAACATTAGTTTTATTGATAGAGTTCTTAGTTTCGAGCAGAAGCTATACGATGATGATTTCAAGAA
          TGAGAAAACGGAATAAAAACTGTAAAGCTTCAGAGCGGAAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0308925
          2340
          FBtr0308927
          2563
          FBtr0308928
          1434
          FBtr0308929
          2337
          FBtr0346590
          2557
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 2 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          RNAcentral - A comprehensive ncRNA sequence collection representing all ncRNA types from a broad range of organisms
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CR31781-RE
          lncRNA:CR31781-RE
          Secondary FlyBase IDs
            References (0)