Open Close
General Information
Symbol
Dmel\CG11000-RC
Species
D. melanogaster
Annotation Symbol
CG11000-RC
FlyBase ID
FBtr0308953
Feature type
Associated gene
Evidence Rank
Length (nt)
6816
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 20 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CCGTCTAACCCAGCAGAGGTGTGCAGCGGACAGCAGTTGAACCACCGCAACCTACAGCACCATCAGCACCATCAGCAGCA
      GCAGCAGATAGAATAGCTGTGACCACAAGAGAACAGGAGCCCTGCCCTTTGATCCACTGCATCCAATGCAACAACTGCCA
      CCGCAATGCCCTGCTGCACTGACAACTGACCCAGCTGCAACTGTTTAACTGGCCGACAGACGGCAGAGCATCGCTATTCA
      TTACGCGTCCATGTTTGTGGTCCACTTGTCGGACGCGGACGCGGGGAGCAGATTCCTCGAAAGTAGGCAACGAAAATCGG
      AAAATCGGAAATCTAATTAGCGACGTCAGTGTCAGCAATGCAAATCCATTAATTTCCAGTCATCACATCAACAACTTTTC
      GGTAAACATGCGTTGCTAGAGTCCTAGCAAAAAAGAAAAAAAAAAAGAATCACGAGAGTTGGGAAAATTTAACGCAGAAA
      AAAGGGAAAGCACTTTCCCTTCGCTGAGCGTGTGTGTAGGTGCGTCGGTGTGTCGCTGTGCTGGGTTATTGGTGTGCCGC
      TGTGCGTGATATTGAGAGTGTGTGTGCGTGTGTGTGCGAGTGCCTAATAACTCGAGCCTGGCGCTGACATCACTTTCACT
      GGGAAAGCGAAATCGAAGAACCAACCTGGAGCCCGGGAATCTGCCAATCGAGCCGCACGGCAACAAAATCAATTAAACTA
      TCAACACTGCACGACAACCGCCAGAACAACAAAGCTGCCAAGAGCCAATTATCGAGGAAAAGCGGAGGAAACCAAACGAA
      GGAACGAAAGACGAGCATCGCAGCCAAGATGTTTTCCATGTGCACCAAGGTGAAATCGCGGAGTGCGGATCCGGACAGCT
      CGTTCATGCAGCAATCACAGCAGATGCAGATGCAGCTGCAGCAGCCCCAAGCGATGGGAACTGGTGGAAAACAAATCAAG
      GGAGGCTATCTACTGCGCTACAAAAAGCAAATGTTCTGGAACCGCTGGGCGGAGGAATGGGTGGTGCTGTACGACGACTC
      GACCATGGCCTGGTTCACGGAGCCGGGACGCTCCTCGCCGACGGGCAAGATCCTGGTAAAGGAGGCGCCTGAGATGCTGG
      CCATCGCCCACTGGACCGGCCAGATACCGCGTCGTCCGCCGCTGCCGGCGGGCGTGAATGTGTCCCAGTTGATTGCCCTC
      GGATCGCAGCGCAAGCGGTCGAAGGTCTACTGGATGCTGGCCAAGTCGGAGCAGGAGGTGAGCGACTGGATCGATGCGAT
      TACCAAGACCCTGCCGCCGCCGCCTCAAATCGAGCTGGTGGTGGACAAGCCGCACCTGATGAACGTGCTCCGTCGTCCGC
      TGGTGCGCATTAGACCGGCCACCCAGTCGGAGGTGAAGCAGCGGAAGGCGGCGTCACACGGAGCCAGCGGCAGTAAACAC
      CACCGCTGCTCGTCGGCGATTTCCACGAAGGTGTATCGGCAGAGCCAGGATCCGCTGGTGAAGAGCGACGCGGCGGTGGC
      CATTCTCAGCAAGAAGCCGGACTCAAAGGCATCGCTGGCCTGCGCCCTACCCTGGGGTCACGGATGGGGATGGGCCACGC
      TGCCCAACGGGGTTTGGAGCGGCGGACTCACCTGGTCGCAGTGCGAGGACACCTTCACCCTGCACGCCCTGCCCACCACC
      CACTGCACCAACCTGATCGACACCTCCTGCAGCGGGGCAGTGTACCACACGGACATCGGAGGCTTCGACTTTCACTCCTC
      GGGCGTCGATGACATCGGCGGCGAGGACTTCGACTATGCCATGGACTGCGGTGATTTCATATTCTAAACTCCCTTCAGCA
      CAACCCACCGGCACGCAGGACCCATTCGTCCTTGGCCGCAGATTTTGACTTCGATTGGAAGGAGCTCAGCAACTGGTAGT
      CGCTTGGGTAGTATATAATATTAGGTGTTGCTAAATGTAAGGGGAAATCGCGGCGTTCCGTATACGCCCCGTTGTCCTTG
      TTCCAGACGGGCTAACTATTCCGCTGTACCCTTAACATTGTGCATTGTCCTAATTGCGTTAGGCAGTTAAGTTCTCAGTG
      TGCTGAAACATACATTAAGTGGTATACATACATACACCATATGTAAATGTGGTTATAGCTGCGGCCAAAGAACTAGTTGT
      GACTGCTTCTAACAATTCCTGATATATGACGGTTGCCAATAAAACTGCCCAGGATATTAACCATCATGGCTACATGGTAT
      TCCAAAAAGTCACGGTCAGGATTCCAACCTTTGTTGCTTAAATAATCAGATTCCCCAAAATACCAAATATGAGCAATTCT
      TAAGTTCAAATCTTTAAAAAATTTAACGCAATTTTATAACGAACAAATTTAATATTTTACCAATGTCACAGCTATAATGG
      CCGTTGCTGTAGTTTCGCCTCGAGCTATGGCTGATACACGTGTGGCCGTGTATTTATCAATATATATTCGTGTTAACCCC
      CAACCCACATTTGCCAACTACCAGCCACCGCCCACTGGCCACAGCACCCCATTCAGCCACCCACCCACACAACCAACCGC
      AATCAGCCATCGCAGTCGCAGTTGCAGTTGCAACCACAAGCATTTGAAATGCGAAAATATTTTTGCATCGCGCATATAAG
      TAGGCTACAACATATTTTCGCACTCGACGAGCGAAGAAATCACAATAAATAATGCAAACGGACAAGGCGACAACTAAATT
      AATACAGTATAATTCGCTTAGCTGCCTCGAGTACTTTGCACAATGCCTCGATGCAGGTAACTTAAAAATGCAGCTAACTT
      AATTTTTTTTTTTCTATTTTCTATTTTCTATTCACACAAAAAAATGGAAAAATAATGCAGATATCTTGCCGATGCAGCTA
      ACTATCGATGCAGCTAAGCGAATTATACTGTAACGAGAAAACAACCGCAAGAGATTGAAATACTTTTGTGTATTTTGAGA
      CTTTTGAAATTTATATTGATGCAATTTGTAATGGAAACACTTTTCAAATTGTTTTGCCATGATTTTCTAGAATTTTTGGA
      ATCGATAGTATTAACCGAAAACCGAATCCGGAAAAAAGCCCACATCCCGCGTTCCCCGCCAAAACCCATTTTTGTGTGCA
      AATTTTTGAAACATTTATACAGATACAGTGCGCGTAAAATAAGTCGGTCAAGAAATCGATGCAAATTTAATATAATTGTG
      TAAAAGACGAACACAAAAGCAACAAAAATAGCGAGACATCCCCGCGGAGTTTTAAACTGGCGCATAGCAATTTTTATATA
      GAGTGTTAAACAGAAATGACAGTAAACAGGAAAACCAGGTAAATAACGAGTAATTAACGAGGTAAAAACGAACTGTAGTC
      GTAAGACCCACACACCGGCACACAGCCTAGTGTAAGTGTTAGCACCTAAGGCATACGATTGTCAGATTGGTTTTCGAAAC
      TAACTCACTCAGATCGACATACCCACCCGTACTGATGTAAAGTTTATAAAACAAATCAAGCGAAACACAGAGACAAGTTA
      GCATCCCAGGAAAAATCACGGAGCATAAGGCCAAAGACGAGTATGTACATGTATATACAAGTAATTAGCGTTAAGAACCC
      ATTCGAGATCACGGACATTTGGGAGCGGAGTCAGCAGCAATCACCAGTAATAATCACCCCCATCGATTCGATTTTGAATT
      TGATTTTGAGGAACTTTCGACACGTCGTGTGCGAAAGGGAAACGCCGCTACGGACACCTTGAGAAAATGTAACTGTAACT
      GTAACTAACTGTACGTTAGGGTATATAGAATCTAGGATAAGAAGTCGGGCGCCCGTTAGAGCCACACAAACATACATACA
      TACCTATGTATATGTTATGATGATATAGGAGTATATAATAGTTGTATGTACGTACGTACCGTAAGAATGTGCAGGTTTTC
      AAAATGTTGCATGCCGCGTAATGTAATATACGGGTAACAGGACACTTCAGTCCCTGCGCATCTGTTGCATGTCCTTGTAC
      GCGCTAATATACTTATACACTACTATATATTTATGTACAACCGTAAACCAGAGCCAAGCTAAACAAAACGAAACCGCAGT
      CGGATACCCTAACCTGAGCCCGCAGCCTTAGCTATCATACCCATCACACCCTACCGCTACCAGCCCTTTAAAGTGTCTAC
      ACACATATGTACGAGTAATGTATCTGCATGAATACAATACACAATACCTATAGCTATAGTCGGCAGACGCGATCGGGAGC
      ATTAGAAACGTACATATAGAACCCGCCACGTAACGTAACGTAATGAAATGTAGACTAAAAGACTTAAGCAATTGTCGTTT
      AGACGTTAAATTAGAGCGCATTGAATGTTGGCTTATAGTTCTAGATACCGAGCGATTCAGGGGCGATGTGCGGAGCGTTA
      GGAACATATGTTATTAAGGATATCCTCACCACAATGTTTTAGTCTGAAGTCTAGCCGAATCGAAATCGAAATTGAATTCG
      AAATCGGAATTTGTTAGCGAGGAAGTTGGAAACGCGTAACCAAAACCAAAACCGAATACAACCAAACAAAAACCAAATAC
      TAATGGAAAACAAAACGAAAGTAAACGTAAAGAAAAGTAAATCAACCTTGGACAATCACGCATACGCATGTAGGCAAACT
      GGATTAAATAATGTATGTAAATTGTTTAAGCCCTGGGTCGGCAGTAAAACAAAAGTGGACCGGCATAGTCTTAGCACGTC
      CAGCATGGAATCCTTAAGGGCTCCGTGAACTCAACTAATCTAAATACACAAAACTAAAGAAATTCACATTCGATTGAGGA
      CTAGAGCCAGGTCATGCTTCAATTAAATGTCAATCCCCACGCTCTTCAGTTGTACCGAGAAGTACATATTTTTGTAAACT
      TTATTAGGAACACCGAGATCTAAAGCGAAACTACTATAGTATTGTAACAAAACATGGATGTTTTAAAACGGAAATTAAGC
      AAACGCAAAACCAAAGTATACTTTAGACGCAATTTTTGTAGCATAATTGTACACGTAAACTGCATTTCCGATGTTAGCTG
      AACAACCGTATATATATATATATAGTATATATATTACATATATGTATGTATATACAGACACCCACATACGAGCGCCAATA
      GAGCGAGATACACCCGTTTTTATTGTGCTGCGCATTTTCAACGTGCGGCTGAACTGTGAATTCGAGTATAGTACCCTAGA
      TATAGGTAGAATCGGTACAAACCAGGTGGTACAGGTGGCATCGCGTGCAAAGCCGCACTTGATGTAACCGAATTATGAAA
      TTGTAGAACCCAATCGGAAATCGGTGGCATGTCGTTGTCAGACAAACCGCGGTATCCGCGGGATACGCCGGAGGGGCACC
      CTCAAGCAATCGGGAGCAAATAAGAGCAACCGAGGGTAACCGGAAGCGGAAGCGGGCCTCCCGCCATCCGGCCATCTCGG
      CAGATGTTGCGCATACGCCCCGGCGGTCGCAGCTGCAACTCACAATTAGGCTAGTAAGTTCGCGTTGTTTGTTATCAGTG
      TCGTTGATGTTGATGTTGAATTGAATTGAAATTGAAATTGAAATTGAATTGCCGTGTCATTGTTAACCGTATTCAAGTTG
      TAAACCGACGGCGTCGGAATTAGCTGTTTTTGGGAACCAAGCGAGGCGACTTAGCAGGGCGGCACTCATCGACCCACGCA
      GGAGATTATACAAATTATACAAGCATTATAAATAGGTGTCCATAGTACCCATAAACATACATACATATATACATAAGCTG
      GTCCAAGGGGCTCTCGAACCAACTCCAACCTCCAGCCAAGTGTCGCGAACTTTTAATCCGCATCCGGCGCGCAGCCTGGC
      CAAGACTCTTCCGAGTCCCTCGACCATCGACTCCCGACCTCTAGAGATCCCTCCAGTTTCCCCGAACAGAAACTAGCGAA
      GTAACCACGTTATTCTATAGATGTGTATGTGTCTATAAATATACTTTGTAGACGTTCACTCGCCGGACGCCGCCGAGCTC
      GAAAAAACTGAACAACCAGCCAACCCGGGAAGCCATCGGCCAGCCAGCCAGAAGCACAAGATCTCTTCAGGTTCGGGTTA
      CACCCACTCGAGCCCGGAGCAAGTGCTGTCATTCTCTTGGCCAACTGGCTAGCTCAGCTGGCCAAGTTAAGAGAGCGGCG
      CAGATCGCTCTCACATGGTTTCAAAACCGCAGCCCAACAACCAAAACAAGCGAACAATGTACGAATAATTATTATGAAAC
      GATGAGCAAATAGACGCTAAGCGAACAGCAAGGAAGCCATCAAATGAATCAGCCAACGAGCGATATACGAAGCTCAATTA
      CCCTGTACATATTATTTTTTCTCAATTTCGTACTTATGACTGTAGAAATCTGTTAACGCAATAAACGAGTTTGGATCTTA
      ATTTGATTATGAAATGTGTAATAATAGGTTGGAAGAGCTATTTCATAAAAATTGTATTTGTGTTTAATTATCATTATAAG
      TTTTGCTCAGCACTTACGTGTTTCCAAAAATTAACCAGATGGGGTAATTGTTATAATGTACAATAAAATGTTTAGATTTG
      CATATTTATTATTATGAATATTTGTATGATTATATTTTTAAATACGTATACTATAAGCTTGTGAGCTTCCCAACTGAACC
      CCCAACTATGATTAACTATTGTTTGCCAATCAAATGCTAAAAATACAGCTCAACCATGTTTTGATTCGATGACTTCAAAA
      GGGGTTGATGCAGAGTTAAAGGCGGAAAACATCTGCGAAGCGTCAGCGTTGATAAATGTAAAACAAAGCAAAAAGCAAAT
      AAAGTTTAGCAACAAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0113195
      2335
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0301052
      332
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0112107
      332
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      Extended 3' UTR based on EST and RNA-Seq data.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG11000-RC
      Secondary FlyBase IDs
        References (0)