Open Close
General Information
Symbol
Dmel\CG4080-RB
Species
D. melanogaster
Annotation Symbol
CG4080-RB
FlyBase ID
FBtr0309506
Feature type
Associated gene
Evidence Rank
Length (nt)
3453
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 70 )
Sequence
TTCAATTGTGTAGGCGCAGTCACACTGGTCGCGTCGCTCGTAGATATCGTGTAAGGATATGTCTCCGTGTTTAGCTAAAT
AAAATACATAAAATATATGTGCAATTCTAACAAGCATAGCCATTTAGCGTAGAGTAGTGGAACGAACAGCTCGTACCGGG
CCAGTAACAACAAATTAACAAGCAAACGCACTAAAGTTTGTCGCGGAATAAAGATATAATAATAGACCAGCTAACCAACA
CAAACAAACACACACACGGCCAGAAGTTCGTTGGCGTTGAAAGGGAAAAATGAAACGAAATGAAAGGAGAATAACAGTGC
AATAGATTCGGTTTACATTGTGCAAAAAATCGAAGTAGCCCCTGCCAACAGGGTCGCTAAAAATAAAGAAGGCGACAGCC
TCTGTTTATCGTTGGGAATAAACAAATATATGGCCAGCGGAGGAGAATCATAACAAAGGCGCAAGACTAGCCAGCATAAA
AGACAAAGGAGCTCTCCTCCCCCGCGTCCGCCACCCCCCTCCCTTTTTGGGGTTGAAAACCCCCCACGCGTTGCGGTGCA
GCATCGCCCCGACTATGCGATACCCTGCAATCGAGTTTATAGTGCTATAGAGAGAGAGAGAGAGAGCGAGTTACGAACAA
AATGCCTTGCGACAACGCCAAAACCTCTTCGGATATCGAGCATGTGGATTGGAATTCCGGCCAGCACTATGCGAATGTCA
GATTCGGTTCGGGCAGCAGCCAGGCATCGCAGAACAGCGGCGACATCTGCCGCATCTGCCACTGCGAGAGTGATCCGCAG
AATCCGCTGCTCACGCCGTGCTATTGCTCCGGCAGTCTGAAGTACGTGCACCAAGCGTGCTTGCAGCAATGGCTCACCGC
CTCCGAGACGAACTCCTGCGAGTTGTGCAAGTTCCCCTTCATCATGCACACCAAGATCAAACCCTTCAACGAGTGGCGCA
GCCTTGACATCTCCGGCATTGAAAGGCGGCGGCTGTGCTACTCCGTGCTGTTCCATTGCGCCGCAGCCCTGTGCGTCATC
TGGTCCCTGTGTGTGCTCATCGAGCGGGCCGCCGACGATGTCCAGCGTGGCCTAATAGACTGGCCCTTCTGGACAAAGCT
GGCCGTTGTCACCGTGGGCCTTACCGGCGGAATAGTTTTTATGTATATCCAGTGCAAGGCATATCTTCACCTCTGTCACC
GTTGGAAAGCACGCAACAGAATTCTACTGATTCAGAATGCTCCAGAAAAGATACATCCAGTGGCACCTCCATCCCCAGTG
GCCGCCCATCATCAGCACTTCAGTGAGCCACTGGCTCATGCCGGATCGACGAGCGGAGCAGTGGAGATCAATGCCAGCGG
TGCAGCCGGAGGATACTGTGCCCACGAGGCAAACTGTGCATCAATGGATAATGGTGGCGGCGGTGCCGAAATGGGTCTAC
ATCAGCAAATGCAGCGCCTACTAAATGCCTCGCCACATCATATGCTTCAAATGGCCGCTGAACTAGAGGTGCCGCACAGC
AGCAGCAGTGCCTGCACGCAGACGGAGGACGGACATGGCCACCAGCGGCACCAGCAGATGCAGCAGAGCGGCCAGCAATT
GGGCCAAGTGGCGGTGGCCGCCAATATCGAGTGCTCGCAGTCACAGCACAATTACGATCGCGACTGGGCCCTCGATGATG
TGGTCTCGCAGATCTCATCATTCCGACCCTGTCCTCAGGGATCGGGCAGCATGACGCCCTTCCACGACTCCATACACAAC
GTGCTGGAGCATTCGGAGGGCTCTAGTCGCGGCTCTGCTACGGATCTGTGCGCCGGATCACGGCAGGATCTCAGTGCCAG
CGGCATTTCCACGGATACAGGCCGCGAGCACGCTCTGCAATTAAGCAGCTTTAGTGGTAGTGGCGAGCACAAGGCACCCT
CGATCAGTTCCGGAGTATCGCATGCAGTAGCCAACGGGCTAGGCGGATTTGTTTACAAGCCGCACCAGACAAAGCGCTAC
TCCAACTCGTCCATCTTTCTCGAGAACCGCGATGTGCTGAGCGATCAGACCAGCGTGGGTCCCGATACTGCCGTACATCC
TTACGATTACAGCACGCCGCCAAAGATCGACTACCGTCACTCTGGGATAATGGGCGTTGATTTGCCCATTGGTTGCTGCA
CCACTGATTGTTTAGGTGGTCAGCCGACGAAGGAGGAACTACGTCGCTACTCGGATCCCAAGCTGAAGGCCGGCGAAGCG
GATACCGTGCTGGATATCGACCTGCCCACATCGCCACTATCACCACCTGCCGCCTATGCCAGCAGCCAGCAGAAGCAGCG
GAATTCCCATCAGCTTGTGATCTCCTCATCCTTTGACCGCGGAGTGAATGGGGTCAGCAGCAGCAAGAGCAGCAGGGGCT
ACGGTCCCTCGGACGCCCAGGTGGATCGCTCGCGGCTCAGTTTCAAGTCGTTGCCAAATCTCAGCAGCAGCTGTGAAAGT
CTACTCCAGAAGTGAAATGGAGTATCCTGCCCAACTGATCTGATGTGATCCACTATGATCTGCGCGCTCTTTCTCCCCCC
AATAAGCTCTGCTCTCTCAAGTATTCACCGCTGGTCGACGGAGACCCCGAGATCCACATAGAAAGTAAAATCGAAATACT
ATTTTTTATACCGCACACCAAGGGGCTTCAAAAGCCATATCGTGGCCAGCGGCCCAACAATCCCTATGTTCTCCTCTTTA
TATAGCAAAGCCCATAAACAATTTGAGACTGCAATGATTAACACAAAACACAAAAAAAAAAGTTAAGTTAAGTTATCTTA
ACATTTAGAACCAGTATATTGATTTAGTGGCTAAATCGATGTATAATTTATCCTCTATTCGTGTACTGCTTTTATTATCC
AGCCTCTCCGATCCCATACCATATACATATATGTATGTCCACTAAGTTGTCCATGCCAAAAAGCCCAAAAACCAACCAGA
GACGGTAATTATTTAGTCCATGTGTAGGATGTGTTTTGTTTCTTAACTTCTAAGTCAAATGAAATTTTAAAAAATTGATC
TGTGATTAAGCGTCATTGAATATACATACATAACGTGCATAAATGCAAGCAAAAACATATTGACAGCAGCCGCAGCCGTA
GAAAATGCAGAAAAATACATAAAATACATTTTTACTTAACATCAACTAAGATAAAACCAACAACAGCAACATGACAACCA
CTAAAAGCTTTTTCGCGGTTAACAGCGAAAGCTCCACGGAGCCGAGAAAACTGAGATATATCCGTATCTCAACACCCAGC
TGAGAAATATGAATGAAAGCCGTTTTAGATATAGATATAGAATTAACAGTAAATACTTATGATCGCTACAAGTTACGAGC
ATAAAACAACCAATATGAAATCAGAACGGGCAACTAAATTTTTTATTATGTATTAAATATTTAAATAAATATGTGCAAAC
AATTGATTAAATT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0076494
2771
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0301283
617
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0076222
617
Comments
Extended 3' UTR supported by RNA-Seq data.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
CG4080-RB
Secondary FlyBase IDs
    References (0)