Open Close
General Information
Symbol
Dmel\cindr-RG
Species
D. melanogaster
Annotation Symbol
CG31012-RG
FlyBase ID
FBtr0310070
Feature type
Associated gene
Evidence Rank
Length (nt)
2976
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 39 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CACTCTGTTTTCTCATTTAGGTCGAGGAAGGCTGGTGGCGCGGTCGTCTGCGCAGCAAAGTCGGCGTCTTCCCATCGAAC
        TTTGTGCAACATATCGAGCCGTCTCCCGTTTTGGCCTCCAAACGGCCACCGACAATTGGCGCCACCGTGACCACATCGGC
        GCTGACGTCCAAGGCGGCCAATGTGGCCAATGTGGCAGCCACAGCCACAGTACCAACCGGCGGAGCAGTGCCTCCTGCGT
        CCACCAGCATCTCCACCTCCACAACTAAGCAGGCAACGAAGAGCAGGGCAACTGCAGCAGCAGCAGCATCTGCTCCAGCG
        GAGCCGGCGGCCATAGTTTCGGGATCGGGAGCAGCAGCTGGTGGAGGAGCAGCGGCAGCAGTGCCCATGTTGCCACCCAA
        GCCGCAGCGGGAGTTCTGCCGGGTGGAGTTCCCCTACGCCCCGCAGAACGACGATGAACTGGAGCTGAAGGTGGACGACA
        TAATCGCAGTTATCAGCACGGAACTGCCCGATAAGGGCTGGTGGAAAGGAGAAATCCGCGGCAAAGTGGGCGTCTTTCCC
        GACAATTTTGTCAAAATGCTGGCACCTTCGGAAGCAACAGCAGCTCCACCGTTGCCACGGCCACGCCCACGCACCCGGCC
        TGGAATGGGCGGAACGGGAGCCGGATCCGGGTCCGGAATTATAGATGGGGTCCGTACTCCACGGCGGACGCAGCGAGGCG
        GCTCTTTCGAGTTCTTGGGCGCGCGTATGGCCAGCTTTATCACCACGATTTTTGCACCGATCAACGAGCCACCGAGTGCC
        ACACAGATTACGCAGAATCAGAGGAAGGTCAGCAACACCGCCAGCACCACCAGCCACATGACCACAACGAACTCAAGCAA
        TTCCAGCACCACCTCGGTGACCACGCAGCAGCAGAAGGAGCAGATCGGAGGCAGTTCCTCCACCACATCGAAGGTGTACA
        TCAAGAAGACCGGGAGCAGTAGCAATAGCACTACCAGCAGCACCACCACAGCTTCCTCTTCGGCGGGTCGCAAGGAGAGC
        TTTGGTTCCCGTGACTCCCTGAACGATATCCTTAGTGAAACGGGTCTGCCCACCGGCAATGTGGCTGCCCAAAGGAAATC
        CCTGGAGAACAAGAACCTGGACCTGACTAAGCCACCTGGAGTGGGAGCATCAGTGTCCATTGGACAGCAGCGGAGCAGCA
        CCTCTAGTGCCACCACCTCCTCAGCCACTACAGTAGCCACTGGACTAACCTCATCATCAGTGAGCAAGTCCATGGAGAAC
        ATGCTGGACGAGAAGGTCAAGTCGCCACCACCGCCGGTGCTCAGCAAGAAGCCCAGTGTGCCGCTCAAGAAAACTCCCAC
        CGGCGGAGTTCCTATGACTGGTAACCTTTTGGGCGGCAAGAAAAAGAATACCGAGGGAAAGCTCACCACTGCCGTGTCCC
        ATGATTTGGCGGATGGTCTTGCGGCCAGCAAGATGCTTTCAGGTGCTAATCAACTACCTGAATCTGGAGCAGCTGGCAAT
        GTGGTGATCCGGAGAGCTGCCACGATTGCAGTGGAGGATACAGATTTCGATCGCGTGGAGAGGGCTTCCATACTCACGGA
        TATGCGGCAAGGAAGGGTCAAGGCGCCAAAGAGACGTCCACCATCGGCGGCTATCAATGTGCTGGGCGAAAGTAATAACA
        ATTCCGTATATGTAAATGGCAGTGGAATGTCCGGATCTGGTGGAGCAGGAAGTGCCAGTGAGTTGAGTGAAGATGGCGGT
        GCTGGAGGGAAGACTTCTGATGACAATTCCACCGGCGAGGAACCACAGTTGGCCAAACCCAAGCCACGTGAGTGGGAGAA
        GAAGAAGGCGCCTTGGATGGAGGAGCTGAAGGCCTCGCAGGTCACCAGGAAAAAGACCTCACCCAGTGTGGAGCCACGAG
        GAGCTTCGGTGGCCGAAAGGACATCCAAACTCTTTGCGGCCGAGCAAGCTGTCAGCAGCAATAGCAGCAGTATCACAACG
        AAAGTCCAATCTTCAGCGGTGACCTCCTCCATGTTTGTGGAGAACTCAACGACCAGCAGCTCGGTGATCACCAGTAGCTC
        CCACACCACCACCAACGATGCCATCATGTCGCGCAGCTTGTCGGCTGCCAAAGTCCAAACCGCCAGCAGCGACGAGGAGA
        CGAGAGCCACAAGGCCAAACAGTCTAGCTATACGAAATCAACGAAGTGTTTCGCCTCTGGTAAAGAGCTCCAATGCCAGC
        AGCTCGCAGTCCCAGGAGGAGAAGCCCACCAGCCAGCTGAACAACCACCAGGATGCCAGTTCCTCAAGGGTGGCCCAATT
        GGAGCAACGGGTGGATAAGCTGGAGGGGCTGGTGCTAAACCAACAGCGAACCATTGAGGAGCTGGTAAATGCCCTGAAAT
        CGGAAGCTGAACGCGTCAAGATTTTGAGGAGCGAACTGGACAAATACGCGCAGTGCGTGACGCAAGTTTGAGCCTAGTTG
        AATCGCCTTTTAGCTAGCTTTTGAATACTTGATTTTTAGCGTCTGCTGAACTCTACAATATACCCAGGCCTAAAAGCGTA
        GAACGTAGTAGAGTAGAGACCGAACCCAAGACAATCCCAAATATCTGTACTCTGTGTTCTGTACTTATATACCAGAATGA
        TCTATCCAAAACCACTAGCGATCAATCGTTTTTGCATGCCAAAACCGTTTCGTTTTTCGCTACAATACTTTGTATTCCCC
        TGTATATCTGATAATTTCGATAAGTATTTTTTATACACTCGTACATTCCGAAGAGCAAAAGGGTGTGATTTCTTTTAGCT
        GCTTTCGATTGCGATTTGTTTTGTTTATTCGATTTATGATTATTTTTTAAAGATGTATTAAAGTTATGAGTAAACTGTAC
        TATAAACTATATACCTAACGAGAGAGAAACATACAAAGTTCGATGGAGTCGATGATGATGCCTAAAACTTAAGCAATACC
        AATAAATAATGCAAAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0085707
        2071
        FBtr0085706
        2307
        FBtr0085704
        3817
        FBtr0085705
        2799
        FBtr0310068
        3897
        FBtr0310069
        2970
        FBtr0310071
        2281
        FBtr0310072
        2225
        FBtr0310424
        4440
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0301771
        694
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0085069
        545
        FBpp0085068
        537
        FBpp0085066
        882
        FBpp0085067
        635
        FBpp0301769
        848
        FBpp0301770
        692
        FBpp0301772
        537
        FBpp0301773
        537
        FBpp0302572
        941
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        cindr-RG
        Secondary FlyBase IDs
          References (0)