Open Close
General Information
Symbol
Dmel\Ca-β-RM
Species
D. melanogaster
Annotation Symbol
CG42403-RM
FlyBase ID
FBtr0310280
Feature type
Associated gene
Evidence Rank
Length (nt)
5025
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 1 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GATTGCCGTGTGTGTTTGTGTCTGTGTCAGTGCCAAGTGCCCAATTGCCCAAGTGTCTGTGTGTGTGGTGGTGCAAGTGC
          CCGTGTGTTTGTGAAAGCCAGGATTGCAGTGCTCCAGCTCCCGAGGAGCGAAATTGCGGAGCCTGGCGAAAAGTGAATGG
          CTAAAGCAGGGCCCATGCTGATGCACAGATGCCCTGATCCTGCGATCCTGCGATCCCGCGTCTGGTCAGTGCTAAAAAAG
          TGTTCAAGTGGAATACCCAATCGTGAATATATATGCTAATTAAATATATATAAATTCGTGTAATGATCGGCATCGTATAG
          TGTGAAAGTTTCATGTTGGACCCGATCTCCTCCAAGTGAGAATTACGTCAGTCCGCCAAAAAGAGATGAGAATCTTCTAG
          CCAGGTTACAATCGAGCCAATAACCAGCGACCAGCAGATGAAACTAAACTAAGCCAAACGTCTTTAAATTGATCCCAGAA
          GCCAGAAGGATTCGCGGCTTATAGCTCAGCTCCATCGAGGAGCCCACTGCAGCACTTTTGTACGCCGTGAGAATTGCGGA
          ACCAACAGGGTTCTGCCGACTCGAACTACTCACAACCGTCATCCGATCTGTCGCTAGACGAGGAAAAGGAATCGCTTCGG
          CGAGAAAAGGAACGTCAGGCCTTAAGCCAGTTGGATAAAGCGAGGAGCAAACCAGTGGCGTTCGCTGTGCGAACCAACGT
          AGCATACGATGGCGCCATCGACGACGATTCGCCGGTGCAGGGCGGAGCAGTTTCGTTCGAGATCCGGGAATTCCTGCACA
          TCAAAGAGAAGTACGACAATAACTGGTGGATCGGCCGGCTGGTCAAGGAGGGCTGTGATGTGGGCTTCATACCCAGCCCC
          GCTAAGCTAGACAACATTCGCATGCAGAACCAAACCAGACCCTCAAGACTGTATGGCACAAAGGGCTCGTCGAGCGGGAA
          TCTTGGTGCGGGCGGACAAGCAGGTGCGGAGCCATCTCGAGATTCCATGGGACCAGGACGACACGGCAAGACACCGGCGG
          CGGCGGCCAACAAGGAGAAGCGAAAGCCATTCTTCAAGAAACAGGAGACGGCCAGTCCCTACGACGTGGTGCCCTCGATG
          CGTCCCGTCGTCCTGGTGGGGCCCAGTTTGAAGGGCTACGAGGTGACCGACATGATGCAGAAAGCCCTCTTCGACTTCCT
          CAAGCACCGCTTCGAGGGCCGCATCATCATCACCCGGGTGATGGCCGACATCTCGCTGGCCAAGCGCTCCATCATGAACA
          ATCCCTCGAAGCGGGCCATCATGGAGCGATCCTCCAGCCGGAGCGACTGCCTCGGCAAGGTGCAGGAGGAGATCGAGCGC
          ATCTTCGAGCTGGCCCGCTCGCTCCAGCTGGTCGTGCTCGATTGTGATACAATCAATCATCCGTCACAACTAGCGAAAAC
          TTCATTAGCGCCAACAATAGTGTACTTAAAGATTAGTAGTAGTAAGGTTTTACAGCGTTTGATCAAATCACGTGGCAAGT
          CGCAGGCGAAAAACCTCTCCGTTCAAATGGTTGCCGCCGAGAAGCTAGCCCAATGTCCACCGGATATGTTCGATGTAATC
          CTAGACGAGAATCAGCTGGAAGACGCCTGCGAGCACATTGCCGAGTACTTGGAGACGTATTGGAAGGCCACCCACCCGGA
          CATTCGAGCAGTGCCGCCCATCGCCCGCCCCCTGCCGCAGGAGGCCTCGCCCTCCGCAGATCCCGCGCGTCTGGGACCGA
          CGCCTCCAGTAGATGGCGAGGAGTTTGTCGATGAGCAGGATCCCAGGATGGGCATGTCCGGCGGAGATCGCGAGGGAAGT
          CGGGAGCGAGACCGCGATAGCAGGGAAAGGGAGAGGGAGCGCGAACGGGAGCGGGATTACTGGGATCGGGAATTCAACAG
          AGATCGCAGCTCCAAGGATCGCGAAAGGGATCTCGAGTGGGAGCGGGAACGGGCTCGCGAGTGGGAGAGAGAGCGGGAAC
          GAGATTGGGATAGGGAGTTCGATTGGGACCAAGGAGGAACCTCTTACCAGCACAGCCGCCGACAACCGACCTCGGTACGC
          CACCAGGAGCGCGGCGGAGGGGTGGGCGCAGGCGGCGGAGGTGGAGGCGTCGGCGGTGGCTACGAGCGGGACCGCGAACG
          GGAGCGGTACGAGCGGCGCGAGCGTGACCTCATGCACTACGATCTCAATAGCGACGAGCTGCTGGACGAGCGCAACTTTG
          AGTATCCGGCGATGAGGAGCGGTCCCAGCGGCGCCTCCCACCACGGCCATCTGTCCAGGGGCGGACGCCTGCTGGAGGAT
          CCGGACTTTGAGCGCGAAGAGGCCCAGATGCGGATGAGCAGCTCACGCTACGGACCCTCGACCAGGATCGACGACCCACG
          GGATCTGCCGCGTGGCGCCACCGTTGTCGATCGCGATGAATACAGTCCGCACAGAGGTGGTGGGAGTAGTAGGAGAATGC
          TTAATGCCATGTCCAGACCTTTAGGTCTGCCACGCCAATCCTCCCTGCCCAGTAATAGAGCACCCGTGTCGTATTTGCCA
          CGCCAGTCCTCCCTGGGCACACACTGGCTATCCTCCTCCTCGCAGAGCAACCTGGATCAAGGACCCCAATCTCGCCGAGA
          GCTTTATCCACTGCTGCATCAGCCGCAGTCCTATTCCCAGCCTCGATCCCAGTACACCAGCCACTCGTATACATCCGCAC
          CACAGCACACCAGTCAGTCGCGTTCCCAGTCCCAGTCGCACTCCCAGTCCCACTCTCAGTATCGCTACTCCGTGCAGGAC
          ACATCGTTTGCCCACCCACCAAGATCCCTGCGCGAAGAGTTCCTCAGTCCCACCATGAGCAAGGTCGAAGCTGTCACCCA
          CGCCATTCGCAACAAGATCATCGTGGAGGAGGACGAAGAGGATATCCTGAGCACGGATCGGTTCTATTAAAGAGATTTCA
          GTCGTCCAACCCGCGTCGATTTTGGTTTGGGTAAACTCTTCCTTGCGGGCGGGAAAGCAAGTGCAGCAGTGCCAAAACAC
          ACGACACATTTGTAAATGTTCCATTCGATGATCAGATCAATTTGATAGATACAGCGACACAGATACATCCACACACACAA
          ACAGAAACACACACACACAAAGTAGCTGGTTAAAGTTAAAGTGAGCGTTAAAGTGGCGGTTAAAGCAAACCAAAGGAAGC
          AGCCCAATGCCAAGTGGGGCCTTATGTGTCTTAAATGCTATAGCTAAGTGTAATCAGATTTTATTTGAGTAATGTGAATT
          TAAATTAAATGGTCTAAGCCTAAGATTTAAGCTAGTCGACAGTGGGAAATTAAAAGTTAAAAGAAAGGAGTCCGAAACCA
          AAGCCAACAGGATTTGTTGGTCCCCAAATGGGTCTCGTATTTGTTATGCAATCGATTGACTAAGTACATGAATAAGTGTC
          AGCTTTAATAATTTAGTGAACGTGTCTTAATCTAAGTCGAGCCACACAAACACACCTCCACACACTCGACACACACACAC
          ACACTCTTACACTCTCAATTGACTGTGAACCGATTGAAATCTCTTTAATCTCAAACCGATACCTATTTCTCGCATCCAGC
          GCTTTTCCTTCTCTACACAGAAAAATTTACACTTACAGTGCGTCTCAAAGCCATATGATCATGAGTTGAAATTAATTGAT
          ATATCCATAATGTATTTATTCTATAATTTTGAAAGCTTAAGCTTGAAGTTTTTAACTGAATATTTCTTAAATACGGCCGT
          ACATCTAATACTATCATTTTATTAGTTGTTAAACATTTGTATTATATATCTTGAATGAAACGCATTGTACACAATTTCAA
          CTTCCAACAGCAATACTTTCGACCTAGATACCTTGCCACACCATATCATGCCACACACCTGCCAAAGCGCACAGTTCGCG
          ATCTCAGTTCAAAACTCAAGTTGAACTAGCCGCGAACGGGCCTGCAACCTGGATAAGGATCGAAAATCGATTCAGGTTTA
          GGTATAGCGATTTAAACTACCAGTGCCTTATAAATCCATCAAATCGAGTTACACGACAGCACTCCACCCCAGATATTCTG
          CATTTCCGCCGCCCCATTAGATCATTATTGACCACCACCAATCGCTAAAGTCGAATGCGTCAAAATTATTGTTCAAGTTT
          TGAATTGTACACGTAATGTTGAGACGATAGTCGTTGATCTGGCCCATTCCGAACGAGCACTCCTTTTACAATTCCAACCA
          CCATGCTAAATTTGTCGATCATTAGTTGTCGAACTGAGCTAGCGCCCAACAATGATGAACCGCACTGCATTCAAATCGAT
          CGCCACCACCTCGAGTAAGAGTCGATGTTCAGCTAGTTTTGATCTGTAAGCACACCCACAGAACCCATCCTACTGTCCAA
          GGACAACAGCTGAATCCTGTAACACGGGGTCAGAGTTTAGTGACAGGTCGGGCAATTTGCCCGCAGAAAAAATCTAGTAC
          TTTTTTATATAAGAGATACAAGGTGATATAACTAATTTTCAGAAAGTAAATTTGAACAGCGCACGACAAATACAGATACC
          TAATTGAAATTGTTAGCCACATTCAGGAGAGGGAGGGTTTAAAAGGTCAGATGGGAGAACACCTCCCATCCCCTAGAGAA
          TTTGAATGGGGTTGACCAAGGCACTGGAGGCGCTTTAACGAGGAACAAATTGAAATTTAAATATATAACGGAACGCAGCA
          AACGATACACAAGCACTTCTTGTAAAAAGTGGCAAAGCAAAATGATCTATGTATTAGCTAAACCTAAATGAAATATTACT
          TTTTAATACTAGCATAAAGTTAAAAACAAAACTAGATACGATCCTTTGCAGCTAAGAAGGGGACAAGCGGAAAACTTAAG
          TTTAAATGGTCAGTTGATGAGAAGTGTGTATGTTAGAATATTGCACATAATTCACAGAACTGGTAATTCAATATATTATA
          ATGGTATATATTAAAAAAGATACACACATTTATAGAGCTGCATATATAAATATGTATGTATGTTC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0300536
          3739
          FBtr0300115
          4963
          FBtr0306386
          5788
          FBtr0310279
          4514
          FBtr0310281
          4461
          FBtr0343615
          4982
          FBtr0343616
          4530
          FBtr0343617
          5400
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0301963
          682
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0289763
          432
          FBpp0289392
          817
          FBpp0297478
          733
          FBpp0301962
          844
          FBpp0301964
          455
          FBpp0310210
          439
          FBpp0310211
          466
          FBpp0310212
          745
          Comments

          Potential to produce full-length polypeptide if non-AUG translation start is used.

          Evidence supports alternative exons leading to premature stop codon and/or downstream start; may or may not produce functional polypeptide.

          Transcriptional initiation is supported by short-capped RNA data (FBrf0209722).

          Extended 3' UTR based on EST and RNA-Seq data.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          Ca-β-RM
          Secondary FlyBase IDs
            References (0)