Open Close
General Information
Symbol
Dmel\wge-RD
Species
D. melanogaster
Annotation Symbol
CG31151-RD
FlyBase ID
FBtr0310425
Feature type
Associated gene
Evidence Rank
Length (nt)
5811
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 57 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      TTAACTTAACATAGTTCGCTGCTTCTTTTTTTGTCCGTCCCGTGGACTTTTCTCCAGAGGATTTTGATTCCAATTCGCAA
      AAGAAAAACATAAATAAGCAACAGATCGTGTGTTGGCCAATAGCTCTGCAGCCAGTGCTCGATATTCACTTGGAAGAACC
      GCGCAAAAACGCAACAACGCAGCAGGAAAGTCGCGCCTCCGCCTCCCCACCAAAAAAAAAAAACACAAAAAAAAAGAAAA
      GATCTCGGATCGCACAGGGTTTTATTTTGGGCAACCGCACTTGGACTGGTGGGTGCTTCGGTTCCCTCGACCTGTGGATA
      GTGCCCAGTGGCGTCGCGTCGCTTTGGATTATGTCATTTGTTTATGGGGAATTGCCGCAGGCCCAGTAGCCAATGTTGCA
      TCCGAAAGAGGCAGCGAAAACCTGTAAAAATGTAGACTGTGTGCGTGTGTGTGTGGGCCAGTGCTAGTGTGTGTCCGTGT
      GCCGTGTGTGTCCACGTGTGTTTGTGTGTGCGGATAATGGACGTTTAGTTTTTGGTCGAATCCGCAAGATATATAGTGAA
      ATAGGTATAGGCTAGAGATCCCAGGGAGCGGTAGCCATACATATATGTGCACAGCCACCGCTACCCGATGGCCACGTTTA
      ATCCTGGCGCCAGCAGCAGTGCCGCCGACGTTCTGAGCGCCACCACAGCAACGGCTACTTTTCTGGTGCCCACCACTGCG
      GCAGTATCGCATCCTGGTGCCCATACCGCCCATCTGCAGCTGGATCAATTCGGAGGCTTCTCCGCGGCGACGGCCACTCC
      CCTGCAGCACCATCACCATCAGCAGACCAACTCGTCGTACACTTTTGTGCAGATCAAGAGGGAACCCTGCCAGGTGTCCG
      AAATAAGCTCGAACAATTGCCACCAGCAACAGCAGCAACATCACCAACACCACCAGCACCAGGTGCAGCATCAGGGCCTG
      TCTTCCGCCTCGATGACCGCCTCCTCCAAGACCATGTCCTCCTCCACACTGACCACTCTCGTCAAAATAGAGGCTCCCTC
      GCCAAAGGTATCGGAATTGGAAAAGTCCACAGGCAACTCCGTTCCCATTGGCATCGCCGTGGCCAGGAAACGCCCGCAAG
      AAGCTCTGGTGCCGGCTATCAACACCCCCGCTACGCTGCCGCTGCAGCCACCACTCAACAAGGACTTGAACTGCTTCGGC
      ATACGCGTCGCTGACCTCGGTGCCACCAGTTGCGGCAATTTGTACTTTACTGGCAACGGCGACCTGATGACCACCGGCAC
      AGCCACCGCCGAGGAACTGGCTCTGAGTGCAGCGGGTGTGAACCGGGCACCCTCCACTTTCTGGCAGTATCCAAATGCAT
      TACCCATTGAATCAGTGATTTCCATGTCGCCCGCCACGGTGGGCCTGCAGTACTCGCGGGAGGCCAGTCGCGGACAGGTG
      GTGCTGCTGCCGGCCGGCCCAACAGCGCTCGGCATATCAAATTTTCCCCTCTTAACGCCCACAGATCCGTTCCAGCAGGC
      AGCGGCTGCGGCGGCCTTCGTCTGGCCCTCGGCCTACATCCCCCAGGCGCCGGCACCTGGTGGTCACTCTGCTGCGGCAG
      CCGCCGCAGCTGCTTCGCTGCAGCCGACGCCCAACTTGTCCAGTTTGCCCAACTTCATCTTTCCCTCGATGGGCGGCCAC
      CAGGCGCTGAGCACAACGCCTTCGTACGCGTCCACCCTGCAGCTGTATCTGGCCGCTGCGGCCACTGCGACGGGCAGCTC
      GACGATGTGCCAGCACAGCAATCAGCAGACCAGCACCACAACCACCAATTCCACCATTAATCTGAGTCTGGCCGCTGGTT
      CGGGGGTCACGCAAAGCGGCAATGCGGCTAGCAGCTTAAGTTCCAGCAGTAGTCTCAGCGCGAGTAGCTCCCGTTTCCTC
      AGCCTGGCCACTGGTCAGACTGGGATTCCTTCACTTCTCTCCTTGCCGCCACCGACAGGTTTGAAAGAGGAGTACCCGAT
      GCCGCTGGCATTGCCGCCCCTTGTGCCGCTCGAGGCGGCGCGGGATAAGGAGCAGGCCTTGAACCTAATGCGTCTGCCCA
      CGCCGCCCACCTCGGCCACCATGGAGCCGTCTTCCCTAGGCCATGCAACGCCCCACCATCTCTTCCAGTCGGGTGCCATG
      GCTACGCCCACGCCAGCATTGCTCAACCTATCGATGCATGGCAACGGTGGGGAGCTGCCTGCTGCAACGCCTCTGCCAGC
      GGTCAGTGATGAAGCGGCGCTGAACTACAAGCTGCATGCACCGTTGACACCGCAGACACCTCCTCGCCTGGCGGACATTC
      CTGTGTCGGGATCGACTCAGCTCTTGCCGCAAATGCAGGATGTCAATATACAGACGGATACGCCCGTTTGCAGTGAAGAC
      GAGAGCTTTCCGGGCTCAGCAAAGCCGCAGGATCCTGCTGCAGAAGCATTTCCGCCCCCAACCCATGTCCAGCCGCTGGA
      ACTAACGAAGCCCAGTGAAGCCAGCCATACCCAGCCTACTGAGTGCCATACCCAGACCGAACCCAGTGACATACCCAGTG
      CCAGCCAGGAGGAGTCAGCGGAGCAGACTCCCCCGGAACCCATAGAAACGATGACGCAAGCCACGCAGGCAGATCAAACG
      TCCCCCGAGGACCTGACCGGTTTGGAGCTGCTCTCGAACATAAGCACCAATAGCAAACCACTGGTGCGAGTAAAACAAGA
      GCCGGTGGAGCACATAGAGCAGCCAGCGCCGCAGCCGCAGCCTGTGAATATAATGCCCTCAGAGCCTACGCTGCCTATGC
      CGCCAATGCTGGAAATGGAGCCCACTTCAGAACGCGAACCACTTGGAGGTCTCAAGCTGCTGTGTGCACTCGCTGAGCAA
      CGCATCCAGGAGGAGGTGGTGCAGGGCAGCAGTCTGTTTGCTACGCCGTCGTCGCGAACGCCCACTCCCACGTCGCTGGC
      CCTGGGAACGACAGCTGCGACGCCGCCCATTTTCGAGGCCAAGTCCTGTTATGCCTTTGGGCAATCGCAGGGTTCCGTCT
      TCCCCTCCTCAACATCCTCCTTTCAGATGCCATTAAGCTCGCCCGGATTCCCCTCGATGCAGGGCATCGAGCTGCCAACC
      ACGTCGGCTGGTATCGTTGCCGAACTGACTCCTGTGAAGCGCAAGAAGCACAAACATTCCAAGTCCTCAGGCAGCGACAG
      CCGCAAGTCGGCACGTTGCAGCAAGAAAAGCAAGAAGAAGCGCCACCACAGCAGCAGCCGCCAGCAGTTCTCCGCTCCGG
      CCGAGGAGGATCTGGACCTGCAGGACGATCAGCTGCAGTCGGAGCTACGCAATGCCCTCCACGCCGTGGATCCCAGCTAT
      GCGCAGCGCTTTGGCCAGGAGGTGTTTAGCATCATGGACAATAGTATGCGTATGCGACTGGCGAAAATAACGCGGCAGTA
      TCGCAAGAAGAAACGGAAGCTGGATGAGATTTCCAAGCACAAAAAGAAGAAGAAGTGCTCCAAGCAGCAGCTCGAACTGC
      AACAGCAGCAGGCATCGCAACAGGCGGTGCAGCCATCTTCAGCTCTGCAACAGCCACAGATGACGCTGTCCAGTGTCCTG
      GGAACTTCATCCCCGTTGCGCGATTACAAGTTCCCAAAGTTTTCGAGCAGTAACCTTCAGGCGTCTAGTTTTTTGCGATT
      CCCGGACAAGACGCACTCCTTCCCCCCACCGCCGTCCCTACAGCAATCCCAACCGGAGCCCAATCCCTTGCCAAGCAGCA
      GCTCACCGAGTACCTCGTCGTTTGTCCGCCTGGAACCCAGCGCATTGGACGCGGCCGTTGCCATTGCACCAACTACCTCT
      TCGACTTCCACCTCCGGCTCACCATCCACCAAGCAGGTGGCTTCCGCGCGGAAGCAGCGCAAGATGAAGGCGAGCACCGT
      CGGCGCCGCTGGAGAGCAGACAGCGGCCACGGAGGCAAAGCGGCGATTTAGCGCCATTGATCGCGAGCTTCAGCTGACCA
      GCGAGCACCTGTATCGCGATGAGACACGTGTCCTCACGGACATGGGTGGTCTTTTCTATGCGGGTGTAATGAAGCCATTG
      CGGCCGCCAGATGTGTATTCAATCACATTGGATGGAGAGCGTGGCAACAAGTCGCATGTAATGTCGCGCGAGGATATACT
      CAAGGATACGATCCTCGAGGTAGCTCCGAAGAGCGTGGAGAGTGTACCAGTAGGCACGCGCCTGTGCGCCTACTGGAGTC
      AGCAGTACCGATGCCTTTATCCAGGACGTGCCATCGACTCCGAGCAGGTCGTCGATGGAACGGCCAGCAGCGCTACGAAT
      GCGGCTACAACAGCGCCGGACTTCGTAAGCGTAGAGTTCGACGATGGCGACAGCGGCAGGATCCGCTTGCAGAACATCCG
      TATGCTCCTCAGCGATTATCCCATAGCAGAGTACAACGATAATCCCCTCTACTCAGTAGGCAAGCAGAAGCGAAGCGCTC
      TGCGCGGGGGTGAAAGTGGACCTGGCGGAGTCACTCAGGACCACTTGACCGTGCCCGGCTGCGAGGATTCGCACAGCCAT
      CATAGCCTGGGGATGAGTAGCGATAACACCACATCGCTGGCGGCAACTATGGAGTTGTTCACGCAGCGCAGTGAGAAGAA
      GCGCCTGAAGAAGAGCCTCAAGAAGATGTCCAAAGCTCAAAATGGCGTTAGTCCGGCCACGGCAACCAATGGTGGAGCTG
      ATGCCGCTGCCTTGGGCGATGGTGTCAGTGCCGAAGACGCCGCTCGTAAGCACCATAAGCACAAGAAACGCAAGAAGCAC
      AAGAAGCATCACCGCAAGAATGGCAGCGAAGAGCAGGAGCAACAGGTAGTCCAGCAGGACTACTCTGCGGCAGGACAGGA
      AGCGACAGAGGCTCCTTCCACAGAGATGTCATCAGCGACCTCAAGTCGCGTTAAGGTGGAGGTCAAAGTGAAGACAGAGC
      AGCTGGAGATGGAGGAGGAGGAGTCCGCATCCAATCTCATGTCAGAGATATCCGATGAGGCCAAGGGCGACGATCTGGTC
      GAGCATAACAACTCCAAGGGAAGCAGCAAGATTGCGGCCTTCCTGCCGGAACGGCAGCTATGGGGTTGGTATGGTACCGC
      CTATCGCAAGGCGGGCGTCAAGGGACGCGCCAGAAAGCAATTTTACAAAACAATCAAAAGGGGAAAGGAGACTATCACGG
      TCGGGGACAGTGCAGTATTTCTATCGACGGGCAGACCAGATCGACCCTATATCGGACGCATTGAGTCCATGTGGGAAACA
      ACCACGGGCAACAAGGTGGTGCGTGTGGCGTGGTTCTATCATCCGGAGGAGACGACCGGCTGTCCAAAATTGAAATTTCC
      GGGTGCTCTTTTTGAATCGCCGCACGAGGATGAGAACGATGTGCAGACCATTTCGCATCGGTGTGAGGTGCTGCAGTTTG
      GCAGTTACTTCGAGAAGTTCGGTGCCGATTCGAAGCAATATCAATCCATATACGATAACAATGATACATATTATTTAGCC
      GGGCACTATAACCCAAGGTTACAAGTGCTAAAACTACAAGACGATATTCCAACTCTCGAAGAGCTGCAGGATACAAATAC
      TACTACTACTACTACAGAAACTACTACCGAGGATTAAGCGAAAAGTGGATAGCCGTGGTTAGGCATAGTGCATACAGATC
      TATATATATACAATATATATACATTATACATATATTTTACTATACGTGAACAGATGAAGCAGATATATACCTATATGTAT
      ACAAATATTATTTCTATATATTTTAAAATGCATTACGTATTTCGTGAACTC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0110835
      5778
      FBtr0310426
      6443
      FBtr0310427
      6293
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0302573
      1669
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0110132
      1658
      FBpp0302574
      1660
      FBpp0302575
      1610
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      wge-RD
      Secondary FlyBase IDs
        References (0)