Open Close
General Information
Symbol
Dmel\Prps-RD
Species
D. melanogaster
Annotation Symbol
CG6767-RD
FlyBase ID
FBtr0310663
Feature type
Associated gene
Evidence Rank
Length (nt)
2118
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 46 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CGCTCAGTTCCATTCGCTCGCTCAATTTCGCCAGATGCGGCGCTCTGCGGCTGCTAATCCCAATCTCCCATTGTCGCTGA
        AACAGTGCACTTTTCACCTTACCTGGCGCAGAACAGCTGAGTGCGTCTTGTTATTAAACGGGTTGTTCAATCAAATAGTC
        GGCGCTTACCTGTCGCAGAACCTTCATCTCGGGATTTGTTTTGTGAATAATGCCCGATAAGAAATGCACGGAGAACGAGC
        AGAATGATTGTGTGATGCCAGTTCGCTCTGCTAATCCGATACGCGCTAGAAGTTTGATCCGAGACAATTTGGAGAAACAG
        GCTGGTTGTCTAAATTTAATCCACTCCAGAATGCCGAACATCAAAGTGTTTTCGGGCACCTCGCATCCGGATTTGGCCCA
        GCGGATAGTCGATCGCCTGGGAATCGATCTCGGCAAGGTGGTTACGAAGAAGTTCAGCAACTTGGAGACCTGTGTGGAAA
        TTGGGGAATCGGTGCGCGGCGAGGATGTGTACATCGTGCAATCGGGATCCGGCGAGATCAACGATAACTTGATGGAGCTG
        CTGATCATGATCAATGCGTGCAAAATTGCCTCAGCCTCTCGTGTTACAGCTGTGATTCCTTGCTTTCCATATGCCCGCCA
        AGATAAAAAAGACAAGGAGTTTTCAGCCAAACAATATACTAGTCGTGCGCCCATCTCGGCCAAATTGGTGGCCAACATGC
        TGTCCGTTGCTGGAGCGGATCACATCATCACCATGGATCTGCACGCCTCACAGATTCAGGGCTTCTTTGATATACCAGTT
        GATAATCTCTATGCCGAGCCGGCGGTACTCAAGTGGATCAAGGAGAACATTCCCGAGTGGAAGAACTCGATCATTGTGTC
        GCCCGATGCTGGCGGTGCCAAGCGTGTCACCTCAATTGCCGATCGACTGAACGTGGAGTTCGCTCTGATACACAAGGAGC
        GCAAGAAGGCCAACGAAGTGGCCTCTATGGTACTGGTGGGTGATGTCAAGGACAAGATTGCCATTCTGGTCGATGACATG
        GCCGACACATGCGGCACCATTGTGCATGCCGCCGATCGCCTGGTGGAGGCGGGAGCCACCAAGGTGTATGCTATTCTGAC
        GCATGGCATTTTCTCGGGTCCGGCGATCTCGCGGATCAATAATGCCTGTTTCGAGGCGGTAGTGGTGACCAATACCATAC
        CGCAGGATGGACACATGCGGGACTGTCCCAAAATCCAGTGCATTGATGTCTCGATGATGTTCGCCGAGGCCGTCAGAAGG
        ACACACAACGGCGAGAGTGTCTCGTATCTCTTCTCAAATGTTCCATACTAAACAACAAACAATCGGCAGAAAAACCAGCA
        AACGTTTGATAAAACAGCAACCAGAACACCGTTAGCAAGCCACAGCAAAATGAAAAGAGAAAAAAACCCACTTTAATAGC
        AATTTGTAATGCAATTTTCAACACAAACACAACAATTCGAAACCACATATTTTGCCATCATCATCGTTATATATTTTTTA
        TGGATTAACTATTGTAATTAAAGTAAATGCAAACTCAGTAGATGGGAAATCGTCATTGTGTAATTATACTAAATAGGAGC
        ATAAAAAATAACACTAAATACCGCAAAAAACAATACAAAAGTACACAAATGCAATGCCTTTCCTTTTGTATAGTAAGTTC
        TTTGTTTAAACAAACTTTTTGCCGTTTTCTGATTTTACAAGTTAACACGAACGATAAATTCCCAGTTGATTGGTGTAAAC
        ATTGGCCTGCTCTTAGAGAGAAATTTAGATTTGTAGATTAACACCGTAGAAGATATACACTCAAAACACACACACTCACA
        CAAACACACCCACATGTACACCCACACACACAACAACAAAAAATTGTAATTTTACACTGTGCAACAACTTTTTGATGATT
        CTTTATTGTAAGCTCATAAAGAAAAAAAAAACGCAAAATACTTGCAAGTTCAAAACAAAATCTAGTAAAATTAAGTAAAA
        CAAAAAAATACAATTGAAAAGAACATAGCAAATAGGCGTTAAAAAATAATAAACAACCAAACAAACAACAAAAATAAAAC
        TAAAGAAAAAAATACAAAAAAAAATATTACAGAAAACT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0076415
        2010
        FBtr0076416
        2163
        FBtr0310662
        2022
        FBtr0333856
        2106
        FBtr0333857
        2079
        FBtr0345032
        1847
        FBtr0345033
        1916
        FBtr0345034
        1859
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0302783
        373
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0076144
        350
        FBpp0076145
        388
        FBpp0302782
        354
        FBpp0305989
        369
        FBpp0305990
        373
        FBpp0311282
        350
        FBpp0311283
        373
        FBpp0311284
        354
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG6767-RD
        Prps-RD
        Secondary FlyBase IDs
          References (0)