Open Close
General Information
Symbol
Dmel\Arp2-RC
Species
D. melanogaster
Annotation Symbol
CG9901-RC
FlyBase ID
FBtr0310673
Feature type
Associated gene
Evidence Rank
Length (nt)
2217
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 60 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Sequence
      CATCTATTTTTATTCAACTCTGGGGAGTAACGAGGGAGTTTTTGTACAGCAGTATAACTAAATTATAAGTATAAATAGTC
      GATAGCGGCAAACTGTTTCGGCCTAAATTTAATTGCGAGTCTAAATTAAGAGTTCAATTCCCAATAACCGCCAAACGAAG
      CGGCGATAAACGTAAGCGATAGAGTGGCGAAGAGAGCAAGGTTCCCGCCCGCGTGTTGTGAGAGTGTGCGAGTGGAAGAG
      GAAAGTGTATGATTAAGTACAATCGCTCTCCGGCGGTCCAAATACAAAAAAAGCCGAAAAGGAATCAATTAACAGTAGTG
      CTCAACAAACGGCCCAGGAAGTCAACAGGAAAGGCGATTGATGTGCAATATTTTGTTTGGTTTTATCGAGCAGAGGCGCT
      GCGAGCTGTGATTTCAAACCGAATCACAACCAACACCCAAAAAGGCAACCTGGTCGCGTCATCAGTGGAAGTGGAAAGGC
      AGTTGCCACAGCAGAGGCAGAAGCAACGGGAGTAGCAGAAGCAGTGGTTTTCCAGAGATCCGGTTTTGAGTCCTTCAAGC
      ATGGACAGCAAGGGTCGAAATGTTATCGTCTGTGATAACGGCACTGGGTTCGTTAAGTGCGGATATGCCGGCAGCAATTT
      CCCCACCCACATTTTTCCCTCGATGGTGGGACGACCCATGATTCGGGCGGTCAACAAAATCGGCGATATCGAAGTCAAGG
      ATTTACATGTCGATGATCTGATGGTCGGCGATGAGGCCTCACAGCTGCGATCCCTGCTGGAGGTCTCCTATCCGATGGAG
      AACGGTGTGGTGCGCAACTGGGACGACATGTGCCACGTGTGGGACTACACGTTCGGTCCCAAAAAGATGGACATCGATCC
      GACGAACACAAAAATCCTGCTAACCGAGCCGCCCATGAATCCCACAAAGAATCGCGAGAAGATGATTGAGGTGATGTTCG
      AGAAATATGGCTTCGATTCGGCGTACATTGCCATCCAGGCCGTGCTGACGCTATATGCCCAGGGTCTGATCTCTGGCGTG
      GTGATCGATTCGGGCGATGGTGTAACGCATATATGTCCCGTCTACGAGGAGTTTGCCCTGCCCCATCTGACGCGACGATT
      GGACATTGCCGGTCGGGATATCACTCGCTATTTGATTAAGTTACTGTTACTACGTGGCTACGCTTTCAATCATTCCGCCG
      ACTTCGAAACGGTTCGCATAATGAAGGAGAAGCTCTGCTACATTGGCTACGACATCGAGATGGAGCAGCGTTTGGCCCTG
      GAGACGACGGTGCTGGTGGAATCGTACACGCTACCCGACGGTCGTGTTATCAAGGTCGGTGGCGAGAGATTTGAGGCGCC
      AGAGGCTCTGTTCCAGCCGCATTTGATCAACGTCGAGGGACCGGGCATTGCGGAACTGGCCTTCAACACCATCCAGGCGG
      CAGACATCGACATACGGCCCGAACTCTACAAGCACATAGTTCTGTCCGGCGGCTCCACCATGTATCCGGGTCTTCCCAGT
      CGGCTGGAGCGTGAGATCAAACAGCTGTACCTGGAGCGGGTACTCAAGAACGATACGGAAAAGCTGGCGAAATTCAAAAT
      ACGCATTGAGGATCCACCGCGACGCAAGGATATGGTCTTTATCGGCGGAGCTGTTCTGGCGGAGGTGACAAAGGATCGCG
      ACGGCTTCTGGATGTCCAAGCAGGAGTATCAGGAACAGGGTCTCAAAGTATTGCAAAAGCTGCAAAAGATCAGTCACTAG
      AGGCGGATGGATGCGAAATCAGTGTGTGTGTGTGTGCGGACCGCAAGAAATAGGATAAAAAAGTGATAGATTTCTTTTCT
      CTATTTTCTATAGGTTTAAACCTTTCAGATTTACGTGATATATCCGTCTATATATGTTTTTTTTTTTGTGTGTGCCTGTG
      CGAGTGGGCGTGTCTGTTGAGCAGGATTGGTCCACTTGCCCTTAGATTATCTATAATCGCAGACATGTCGTCACTGGTCG
      TTATCCCCGTACAATATAATGTAATATTTCTTTGAGCGCGAAAACTTTAATTCGATAGTCGCCTAAATTGTGTAACCCTG
      CATTAGTGTGTTTAATTGTTTATAATTACGTCTAAAATTCAAACCCAAAAGCCCTTTTCTTTAATGAATACGCATATATA
      ACTATATATATATACATATATAAATTCAAAGCACCTCGAGTGCGGCGATATTTTTGT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0074295
      2219
      FBtr0112868
      2475
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0302793
      399
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0074070
      394
      FBpp0111781
      394
      Comments

      Transcriptional initiation is supported by data presented in FBrf0213250.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      Arp14D-RC
      Arp2-RC
      Secondary FlyBase IDs
        References (0)