Open Close
General Information
Symbol
Dmel\CG11309-RC
Species
D. melanogaster
Annotation Symbol
CG11309-RC
FlyBase ID
FBtr0321282
Feature type
Associated gene
Evidence Rank
Length (nt)
1302
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 12 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TCGTTTATATGTCGACATTTCGAGATAAGTTCACAATACATAAGTTTGTTGTCGTTACTGATAAGGGCCGAAATCGGCTA
        AACTTTGGAATTGGTGCTCATTCGCTTTTTGGCCACTTTCGAGCGCAGAAATGGACACGGACGACAACTCAAGTGGCACT
        ATTACCGGCAGTGATCTTGGCCAGCGTTATCGGCATGCAGGCGACTTAACTGGCGAAGCCCCAACCAGACCCTTCGCCGA
        GATCAGCATTACGGTTCCATGGGGGCACATATCCGGCAAGTGGTACGGTCCGCAGAACGTCCAACCAATTTTAGGACTGC
        ACGGGTGGCAGGATAATGCGGGAACCTTTGATCGCCTGATGCCGCTGCTGTCGCCGGACGTGGCATTCCTCGCGATCGAT
        CTTCCTGGTCACGGGCTATCGTCCCGACTGCCTGATGGCTGCTACTACAACTCCGTGGATAATCTGTATGTGATCCGCCT
        GATCATGAAGCAGTACAAGTGGGAGAAAGTGTCCCTGGTTGGACACTCAATGTCGTCCATTATTTGCTTTGTTTTCGCCG
        CGGTCTTTCCGGACAAGGTGGACATGATCATTGGGATTGATGCCCTGAAACCTCATCAGCGTCCGTATCCGTCGGTTATT
        AGGACCATGGAAACCCGTTTGGACGAGTTCTTGCGTGAAGACGAAAGGAACCGGAGTAAGAACGAGCCGCCGAGCTACAC
        CTACGATGAACTTATTGAGAGGGTCTATATCGGCACCTTCCATTCGGTGAACAAGGAGCACTGCAAGCATTTAATGGCTC
        GCAACATCGGCAAGTCGGAGAAGTACCCGGACAAGTACTTCTTCTGCCGCGATAGGCGTCTCAAGTTTTACAACTATGCC
        ATCGGGTCCCAGGAGCTGTGTGTGGAAATGGCCAATCGGATTACATGTCCTTACTTGTTCATCAAGGCCGCCCAGTCCTC
        GTATTTCGAGGACAAGAAGTACTACGACGAGGTGCTGGATGTGCTGTTGAAGAAGCCGAACTTTGAGTACCTGGAGGTTA
        ATGGCTCGCACCATGTGCACATGAACGATCCAGAGGCCATCATTGCACCGGTCAACAACTTTATCCAGCGCTTCGGACCG
        GCGGCAGCGGCTGCATCCCGCCAGAAGGCCAAGGAGGCGAAGGAGAGCAAGCTTTAGGCCAACGGTGTGGTAAATAGAGC
        TTATTTATTGTAGTACAGATTGTACAGGTTTTTATACTTAATTGTTTATGCTATGTGATCGCGGCAGAGGACTCGGCTCT
        GCTATAAATACACAATGTACAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0078407
        1664
        FBtr0078406
        1430
        FBtr0321283
        1536
        FBtr0331798
        1206
        FBtr0345883
        2125
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0302828
        348
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0078061
        358
        FBpp0078060
        348
        FBpp0302829
        348
        FBpp0304183
        348
        FBpp0311813
        348
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        Transcriptional initiation is supported by data presented in FBrf0213250.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG11309-RC
        Secondary FlyBase IDs
          References (0)