Open Close
General Information
Symbol
Dmel\CG11309-RD
Species
D. melanogaster
Annotation Symbol
CG11309-RD
FlyBase ID
FBtr0321283
Feature type
Associated gene
Evidence Rank
Length (nt)
1536
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 15 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TGTGCAAGTTTAGTGAACAGCTGTAGTAAGTGTTTATTTTTCGTTCGCTCGATGCTTTCACCTGTTTGTTGGGCGCATTG
          GTCGTTACTGATAAGGGCCGAAATCGGCTAAACTTTGGAATTGGTGCTCATTCGCTTTTTGGCCACTTTCGAGCGCAGAA
          ATGGACACGGACGACAACTCAAGTGGCACTATTACCGGCAGTGATCTTGGCCAGCGTTATCGGCATGCAGGCGACTTAAC
          TGGCGAAGCCCCAACCAGACCCTTCGCCGAGATCAGCATTACGGTTCCATGGGGGCACATATCCGGCAAGTGGTACGGTC
          CGCAGAACGTCCAACCAATTTTAGGACTGCACGGGTGGCAGGATAATGCGGGAACCTTTGATCGCCTGATGCCGCTGCTG
          TCGCCGGACGTGGCATTCCTCGCGATCGATCTTCCTGGTCACGGGCTATCGTCCCGACTGCCTGATGGCTGCTACTACAA
          CTCCGTGGATAATCTGTATGTGATCCGCCTGATCATGAAGCAGTACAAGTGGGAGAAAGTGTCCCTGGTTGGACACTCAA
          TGTCGTCCATTATTTGCTTTGTTTTCGCCGCGGTCTTTCCGGACAAGGTGGACATGATCATTGGGATTGATGCCCTGAAA
          CCTCATCAGCGTCCGTATCCGTCGGTTATTAGGACCATGGAAACCCGTTTGGACGAGTTCTTGCGTGAAGACGAAAGGAA
          CCGGAGTAAGAACGAGCCGCCGAGCTACACCTACGATGAACTTATTGAGAGGGTCTATATCGGCACCTTCCATTCGGTGA
          ACAAGGAGCACTGCAAGCATTTAATGGCTCGCAACATCGGCAAGTCGGAGAAGTACCCGGACAAGTACTTCTTCTGCCGC
          GATAGGCGTCTCAAGTTTTACAACTATGCCATCGGGTCCCAGGAGCTGTGTGTGGAAATGGCCAATCGGATTACATGTCC
          TTACTTGTTCATCAAGGCCGCCCAGTCCTCGTATTTCGAGGACAAGAAGTACTACGACGAGGTGCTGGATGTGCTGTTGA
          AGAAGCCGAACTTTGAGTACCTGGAGGTTAATGGCTCGCACCATGTGCACATGAACGATCCAGAGGCCATCATTGCACCG
          GTCAACAACTTTATCCAGCGCTTCGGACCGGCGGCAGCGGCTGCATCCCGCCAGAAGGCCAAGGAGGCGAAGGAGAGCAA
          GCTTTAGGCCAACGGTGTGGTAAATAGAGCTTATTTATTGTAGTACAGATTGTACAGGTTTTTATACTTAATTGTTTATG
          CTATGTGATCGCGGCAGAGGACTCGGCTCTGCTATAAATACACAATGTACATAAGCCGAGGGGTTTTTCGACTGCGCTTA
          ATGGGGAAGTCGTGAAGGATACCAAGAAACTGGTTATGTACAAGCTTAACCCTTTTGTATTGCGCCCAAATTGTATATTT
          CAAAACTTTATAATTTATTTCAGCTCGAGCATCAATAATTTCGCTTTTTTGAATTGATATATAAAGAAGAGCTTACCATT
          TTATTATCGTTTAAAT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0078407
          1664
          FBtr0078406
          1430
          FBtr0321282
          1302
          FBtr0331798
          1206
          FBtr0345883
          2125
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0302829
          348
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0078061
          358
          FBpp0078060
          348
          FBpp0302828
          348
          FBpp0304183
          348
          FBpp0311813
          348
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG11309-RD
          Secondary FlyBase IDs
            References (0)