Open Close
General Information
Symbol
Dmel\chif-RD
Species
D. melanogaster
Annotation Symbol
CG5813-RD
FlyBase ID
FBtr0321313
Feature type
Associated gene
Evidence Rank
Length (nt)
6170
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 46 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      GCTGCTGCTTCTTCTTCTTCCACCCGCTTGGGTCGTGTTTCTGTGTTCCATTTAGTTTGGAATTAAAATAAATTAACTCA
      CACTTAACACTCGATGGCCTTTTAGGCAATACATACCGAAATGCATCCAAGTGCAGTTATTGATTTGATTTGTGTGTATC
      CGAATGCAACATTGCATAACACACATCGGGAAACGTACAAGGAACAAGAGGAAGAAGAACCACCGGGAGTAGGATTTCCC
      CCACAGTGATTTATTTGTTTTTATATCATTTTTCGTGGCAAACAAGTTTAAAACGCGCTAATTTGCGCCAGAAGGTATGC
      AACCGCAGTCGGACAAACAAAGCGCCAGCAGACTCGCAACAACAACTAGCCACTCAACAGCAGCAGCTTCCGCAACAGCA
      GCAACTCCTCCTAAAGTAAAGGTCATAAAGAGCAAACGCCCCCTGTGCCACTTTAAGTTCTACCTGGACATTTGCGATCA
      TCAGTTAGCAAAGCGCATTGAGTCCGACATCAAAGCATTGGGTGGACATCTCGAGTTCTTTCTCAGTGACGATATAACAC
      ATTTTGTCACTGATAAGCCAGAGGTCATAGGCGGAACCTCCGGAACACCAGGTACACCTAGCACACCCGGCACCCCCACG
      AGTCACTACCAGCAAAATGATGGTTCGGCAAGAAAACCGAATCAGAGGCAATCAAGAGCGGATGCAATACTGAGTCGCGT
      GCGGCGGAGCACGGTTGGAGTCGTAAACAGTGGCAATAGCACACCCACGACATCCCTAAAACGGAGCTATACCATCTGGC
      AGACGGATTATGCCCAACGCTTTATAAAGCGCATTCAGACCGAGCTTAAGCAATACCTTGAGGGTAAGAAGGAAGGTGGA
      GGAGGATCAACATCAGCTAGCCCCCATCATATACAGCTAAAAAAGCAGTATGTGAAGATCGAATCCGTCAAGCGTAATTA
      TAGACCTTACTACCATCTTATCAAACAGCCAGACGACTGGCCAAAGATAGATTTAAGCAGCGAAGACGGCGCCTTTCGAC
      TACTAACAAAGTCGAAGACCAAGGATAAGGAGCATAGCATGACCCGCAAGCCTTTGGGTTCACGCACATCACAGAAAGAC
      AAACAAGCTGCTGGGGAAGCAAAGCCACTCCAGCATCCTTCTCTGCAGGAACTTAAAAAACAGTCTGCGATTCCGAATAG
      TCCGCGTTCCAATTGTCGCGAACCAATAGATTCGAGTGAAAAACAAGGTGGAGTGTGTGAGATCTGTAAATTGGAATACG
      ATATCCTGAATATCCATTTGCAGAGCAAAGATCACGAGCTGTTTGCAAAGAATTCGGATAATTTTCTGGCTCTAGACACT
      CTAATTCAAAGTTCGGCGGATGTGAATAGGTTCCTGGAGGAGGAGCCCGTAGAGAGTGAACTTGACATGGATGTCGATGA
      ATCGTTGAGTAATGAGGAGTTGCAGAGTCCCCGTCAGAGGCCATCGCCAGCGTTGCGGGAGAAGTCCAAAAGGATAACCA
      AGGGAAAGCATTCGTCAGAAAAGTTTCAAGGAGTTGCAGTGGCATCACCTCAAACGCCATTCCCTGGTGCCAAGAAGGTT
      CAAGGAAATTCACCTGGTAGTCTTTCTGAACTTCAGCGTCAGGAACATCCAACAACAGCCGCAGCAACGCCAACAACGAA
      TTCAGGACGAAGGAAAACACAGAACTCCGGTCTGTCACCCCCTAAGAGAGCCATGTTGCCGCCTTCTTCTATTTATAAAG
      TAGTAGAAACTAGGGAGGAATGTGCTACGCCTCCCAGAGGGCGAGGAAGACCTCCCAACCAAGTGGATTCGCCCTCGCTG
      ATTGTAAAGTTCCAAAAGATCCGACAAACAGAGTTACAACGACTCAATGGAGAGGCAGAGAACTTTATGTTTCCCAGAAC
      AGCGGTGCCAACTACAAGGAGCAGCAGTGAGCTGCCCACGGATGTCGATCGACAAACCACCTCGGATGTAAGAGGCAGAT
      ACAGTATCTCCTCCGCCAGCCTAGACACTAGCACCAGCGAAGCAGAAACTAAGGAATCTTCAGGATTACCTACTAGCATA
      CGCAAGCGAGCTCAAGCAGTGGGAAGGCGAAGAAAAGTAGGAGGAGCAGCGGCGCAGGATGTTTTCCAACGCCAATTATC
      AACGGGGAGTAGTAGCAGCAATAGTAACCAGCAGCGCTTTCCAAGCGCCCCCATCCAGCCAGAAGAAGGGCCTCAACCGC
      AGCCAAAACCGCAGCTAAAGATCAAGATAAAGCAGGAGCAATTGGTGGCCACCAGGAAAAGCAGTCGCACAGCTACGGCT
      ATTGTGACAGCAGCCACCGCCAGCAGTCATCAGCAGCAGCAGCTAAGGCAGACAACTTGCCGGAAAATGGCCAATAAACT
      GGAGGATAGGATGGGGGAATTAGTAAAGCCCAAAATAAAAATAAAGAAGGAAGTGATCGAAGAGCAGAAAGTGAAGGAGT
      TGGAAGATCTGGAAGAGATATTAGATAAAGAATTAGATGAGGAGGTGGACAGTAGTTGCAGTAGTGGTAGCGATGAAGAC
      TACATTGCTGGTAGCCAACGAAGAATCACGGCAGCTCCTCGTAAATCAACAGATACTCGTGAACAAAGAGCAGCTAGGCG
      GCTTTCCAGATTAACCATAAATCGTAGTGCCGGAGAGCTGGAGTTAACGGAGGTCAAAACGTCTCCTTCGAAAAGCCGCA
      CTAAGATCCAGAAACCGTCAAGTCCCACGAAAAATAAAGTTAAACAAACGAAGGCAGTGCCACCAGCGATAGATTTATTC
      TTTGATTGCAGTAAAAGCGAAAGACTTCGGGAAATGCAGTATACCTTCGAATCGTTGCCAAGTGGGGAGCTTTGGAATAG
      AGTTTTTCTGCGACAGGATGCGGGTGAAGAGAACTATTACACGTATTATGGTAGCACTAATTATAGGAAACTGCCCTATG
      AAATGGGTCCCATACCCATGGCCAAAACATTGCCAGCACACAGTTGTGCATTATGCCGCGAGGCAAGCGAAGTAAAGCAG
      GATAAGGGAGAGCAGATCAAGCTGGAAGATCAGAAGCCCGCGCCCAAGAAAGAAGTTAAGAAGGAGGAGGAAGTCCAGTC
      CTCTTCCTCATCCGCGACCTACAAGAACAAAAAGCTCCATCTGCTCCAACGTTATCAGCAGGAACAGGAGCAACTGCAGC
      AGTTGGAGGGAAATTCCTTGGCCACTGCCGGAGCCAAATGTGATAGCAAGGCGAGCACACCAGAATTACTGGAAAGGGAG
      TTTGCCTCGGGTTCTATGGGGGATAGAGTGCAGCTGATAGAGAGAGTGAGGAGCACATCCAGTTCAAGCTGCAGTAACAG
      TCAACGGAGCGGCATAACCTGCAGGAATAAGCAGCTGGCCCGGATTGCCGAATTACCACCAAGAAAATCCCCTAGAGAAC
      ATGCTTCTACTCTGGCTTTGGTCAGTTGCATTATACGGCAGCGTCAGGACTCACAAAGTAAAACGAACTCAGAAGCAGAA
      GAGCCACCTCCTCCTGTAGCCGCACCAAAGCTTAAAACTCCGATAAAACAGGAACCAGTAGCACCTTCATCGCCCCGAAC
      GACTCGTTCTCAAGCTGCGACTCCTGTTGAGGAACTACGATTTGCCACCGAGATTAGCGAGACAGTAAAGAGAATGAGGC
      GGGGGCAAAACAAATATGATCATTCCCCGCCAGCGCCAGTTCCTACCCCCGCAACTTCTTCACCCGTTAGAAGTCGCCGC
      CTGACACCAGCGGCTCGTAATCAGAGTCAGATTTATTCGCGCCGATTGGAATTCGCAACCAGTCAAAGGGAATCCTCAGC
      AAGTGCGCTTCTGGGTAAGCGTAAAAGAAGAGTTAATCCTTCCGTTGCAGGCACAGTGCGACCGACTACCCAAAATCTTC
      CCGGAACGGGTGCGTATCGTGGAGTCCGCAAATTGCCCAGCAAGAAGGGATTGCTCGAATACGAAATGGAAACGTGTGCC
      CTTAAAGCTTTGGATCAAGCCCGTCAGTATTGCAATCCTGGCTTCGTTGCCTGGCAGTTAGATAAATATCTGGAGCTAGC
      TGGCAAGGAGTACGATATAGAATTTGACCAGATATCACCGGAGGTGGAGTCTGAAGGACGAGAAGAAAGACTTGTTAACA
      CACCACAAACTCCACCACCTACTGATTGCTTTACAAGCGAGTTTGACTTGTGCGATCTAATTATGGGTAGTGCAGGGAGT
      GGAGATGATGATGAAGATGTATCCAGAGGAAACCCACCTGGTTCCGGTCGACGAATGAGTAATCTCAATCTATACGCCAG
      CTATTATAGGAAAAGGAAGAGCCTGAAGTCCAATCGCACGGGTTGGCCTAAAGCTCAGAGAAGACGGAACGCAGGCGGAT
      TAGGTGGCAGTCGAGCTTTGCCAGATGAGCGAATTAATTTCCAGAAAATGGGTCTTGCTGAGCTACACCCTATAAAGCAG
      GAGCCAATGGAAACGGAAGAGGAACAGACCACAACCACTACCACAACTACTACGACTTCTGCGACGAGAGGAAATCTCCT
      GAGCAAAGACGATGAAGATGATGAAGGAGGCGGAAACTCGCCCTCTGGTGGATCACCTGCTGATGATAAACAGAATTCCC
      GCGAAGATGCCGTGATGACTCCGCCAGCGACCGATGTTGACGAGCAGGCTGAACCGCAGGCGGATGAAATGGAAAGTCTG
      CCCGACGAAGATGAAACAATGGCGGATTCTGTGGATCAGCAGCAGGATGTTGAGGCGGAAATCGAAGCAACTGATGCGGA
      TGTCGAGGAAGAAGAAGAGGAGGAGGACGAGGACGAAGATGTTTTTGAAGATGCCTACGAAGAGCAGGACATGGGCATTC
      AGAAAACTGAGCCTCATGAAAAAAGAGCTCGAATACCTTCCATATCGGTAACCACGCCGCCTGAAGACTCTTCACAGGGC
      AAAAAACTCTTGCTTACTCTGCATAATGGCCAGCGACTACAGGCCACCTCCACACCAAGTACCGGGCAAGTTCAACAGCA
      TCAGAGAAGAACTCCCCAGCTGAACGGAAGTCTAGGCAGCTGTATTTCGCCAAGTGAGAAACTGGGTGACAATTCCGACA
      TATTCACGGTATCATCTGACGGCTTGGATACCGATTTGGATTTAAGCAACACCCAGGCAGGCGATTCGCATGAGCATTGC
      CCACACCAGACGACGCCGAAGCGGAAGTTTGACATCTCCAAGTATGCGCCACCGAATAGTGGAAAGGCGGCGAGCAGTTG
      TGCCGCCGAAGCGGCGACGGCTGCCGTGAAGTCATTGGCCATCTCGCAGTTCCTGAAGAAGGAGGTGCGTGTCACCTGCA
      GGCGACTAAGGGCGCCATTCCGACGCTTTCGATACCGTCGCTGAGCACCCTGTGTCATCTAATCATCATCCAGATCAAGA
      AACGCATCATTCAGCACCAATCACGTATAGCTTTTAGTGTGTACAGCCACGATGAGTAATAAGTTTCAGTTTTTAGGTAT
      TTTTAGGCCACAAATCCCTCCAAAACCACAAAGTCACAGCGATTTCAATTCAGTCAATTTTCCAGTTTTAATTTTTCTGA
      TTTGGCAAAGTGGAAATTAAATGATAAACGGTCTAATGTACCCATTTAATATACTCGTTTGAGACAAAGAACCACTGCCA
      AAATTGTGTAAAAGCGAATATCATTAATGTTTTCTGAAAACTCTAACTGTCAAATGAAGTCCGTCAAATTTAATCGAGTT
      AGATCGTTAGAAGAGTTCATCCCATTTATCAGCTAAGTGTAGCATAATAAAAACCCACAAACAATCACACACGAAAATAC
      GTACATAAGCCTTAGTTTAATCTTAGTTTAGCTCAAATTCCCTGCCCCCCAAAAGAATTCTCATCAACCAATTCGGACTA
      TTCCAAAATCGCTCATTTTCAACCTAGTTTTTAAGTAGTAAAGATTCCATTAATCGTTTTTGTTTTTAATTGTGGAAATC
      ATTTTCTTAGCTATGTACTATTATCAAAGTCAACGCTCAAGCAAAATAAAAAAGGAGAAAAACGTAAACTATGTAACAGA
      AAAACAATTAACTTTAAACAAAAAACCAAAAGCAATTGTAAAAATATTAAAACAAAGAGTAAATTAAATTAAATATTCAA
      TTAAACATAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0080838
      6624
      FBtr0080839
      6575
      FBtr0475053
      6575
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0302856
      1695
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0080396
      1711
      FBpp0080397
      1695
      FBpp0423267
      576
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      Alternative 5' exon supported by RNA-Seq data.

      Transcriptional initiation is supported by short-capped RNA data (FBrf0209722).

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      chif-RD
      Secondary FlyBase IDs
        References (0)