Open Close
General Information
Symbol
Dmel\kmr-RI
Species
D. melanogaster
Annotation Symbol
CG34383-RI
FlyBase ID
FBtr0329899
Feature type
Associated gene
Evidence Rank
Length (nt)
10319
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 59 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TTAGTTTACTTTGAGACGGCGACGCAGGTGGACGTGTCCGAGTGCGAGCGAAAGAGAGCGATAAACGCGAGCGGACCGCG
        TTATAAAATATTACAAAAACAACAACAACAACAACGCCAACAAGAGCTCAGTTCATTTCAGTGTTTGTCTTTAGTTTTAT
        GGCGCACGCTGCGCGTCAGGTAGTTTTTCAGTTGTATATATGTACGTATGTACATATAATGTTTTTTTGTGATTCGTCTC
        GCGGCAATGTTTTATGGCTGACAAAACCATCGAGCGTGTAAAGGTTTTGCACTAACCGTACGACGAAAAAGAGGAAAAAA
        AAAAGAAGTGATGTACATTCTACGAGTAGATGTAAAGTGCTAGTGTTTACCCTTTTTTGCCGGGATTACTCATCATCGCA
        TCGGCGCATCATCGACACCATCATTATCATTCGTTTACTAGCGGGCAACTTTACGAAATCCCAAAAAACCAGTATCGCTG
        TGCCCAAGTATCTGCAAGATACGTGAGGCAGTCCAGACCACATATTGGAATTTACTTAACACGTATGCAACACGCACCCA
        TACCAGTTAACATCGAGCGGGACCCATTGGATTTTGGAACCGAAAACTACAGGACTTTTGCCTGATATTACGCTCCCAAT
        GACGACGACGACGAAAACAACAACTTCCTGAGTCTATTGGCCAACACATCGGCTAACCCCAGAGGTTGGAGGCGCCGCCC
        CTCTTCACCGCCGGCACCATGGACGCCAAGAAGCTGCAGCAGCTGCAGGAGGCAGCGATCCTGGCGCAGCAGCAGAAGAA
        GTTGCCGCTGGCCTACCAGACGAATCTCGTGGACTACCGAACGGCGGCGTACAGTCAGGCATTGTACCAACAATCGCCCA
        CGGCCACCAGTTCCAGCGGCGGTGGACCCCTGTCGCCTATTGACATGCAGCCGCAGTCCAAGCATTACAATCTAATGAAG
        CACGGCGGTGGAACATCGAGCAGTTCACACAGCTCCCCCTACCATCAGTCGTACTCCAGCAGCGGAGGCACTGCGGCCGG
        GGAGCAGCTATATCAATCGCCCACGGAGCGAACGTATCTGGCGGCAGCTGGAAGATTGCATGCCAACAATGCCATGGCAG
        GTCATCATCCAATTTCGGCACTGCAGTCGCAGTATCAGCAGCTGCAGGCGGCCAAGATGCAGGCACAGATGGCCACACAA
        AGCGAGGCCGCCCAGCAGCAGCAGCGGACATTTGCCTTGCGACAGGCCATGAACCCGCCCACAAATCACTACCACATGAG
        TCAGTCGTCCAGCATGGTCTCCACCATGACCGCTCTCAATCAGCAGCAACAACAGCAGCAGCAACAGCAGCAGCAACAAC
        AACAGCAACAGCGGGCTCCACCCTCTTCGCTTAATTTGCAAAATCAATATCAACCTGCCCAGGGTCCTCTCAAATTGCAA
        CAGCAACAGCAGCAGCAGCAACAGCAGTCGCAGCAGCCTGCAATGCCCAAACACTACCAGGAGCAATTGTACGCCCAGCA
        GCAGCAGCTGCAACAGCAGTTGCACCAGCAACAGCAACAGCAACAGCAATTGCAGCAACAACAACAGCAGCATCGACACA
        AAAACGACTTGCAAACCCCGGGCAGCGAGCATGGTACCGTTTATATTCAGCAAAATCATCCCAACCATGTGGTGAACCAA
        GCTTGCCAGACCCAAATATCAGCGGTCAAGCCCAAGGCCACGCCCAGTTCGGAGGAGTCATCATCGAACTCGACCAAAAG
        TCCCAGCCATGCTCCGTTGGATCGCAAGAAGAGTGCCGGTTCCATACAGGCTCTAAAGTCACCCATTACCAAGAGGCCAC
        CATCCACGCCGGTTACCCTATCGGGTTGGCTGCACAAACAGGGCTCCGATGGCCTGAAAGTGTGGCGTAAACGTTGGTTC
        GTTCTGGCCGAGTACTGCCTGTACTACTACAAGGGACCCGAGGAGGAGAAGCTTTTGGGATCAGTGCTGCTGCCCTCATA
        TCGCGTATCCGCCTGTTTGCCCGAGGACAAGATCTATCGCAAGTTTGCCTTTAAGTGCGAGCATCAGAATATGCGTACCT
        ATTGGCTGGCGGCCGATAATTCGGAGGCTATGATGCAGTGGGTAAGGGCACTGGCAGCGGCCAGCTTAATGCAGGCACCC
        AGCAGTGGGGAATCGGAGCCAAGTGTAAATTCCTCGCTGAATCACAGTGGCGAGAACTCCGATTCCGGCATTCACACATT
        GCAATCGCACCCTGGCAAAGGGCAGCCAACACCATCGTCGGAAAATACGGGCAGCAGTGGAGGAGGCAGTGGGAGTGGAC
        AACCCCTCTATGCAAATGCACCACCCAAGCCGAGACGCATTAACGATGGTGGCTACTCGTCACCATCACCCGAGCACAAC
        GAACAGCAGCAGCAACATCCTAGTCGCCGCCTTATGTCGCCCACGCAGCAATTGTACCAGCAGCAGCAACACCAACGATC
        TCAGCAGCAACAGCAGCAGCAACCGCAGCAACATCACGCCATCTATGACACTCGAACTGGACATGTGTCCACCGCCTTGC
        AGTTGCAACAGGCGCAGCAGCAGTACTCCCTGGACCATCTGGAGGCGCAGTTCCAGCAACAGCAACTGGACATGGAGGAG
        CAGATTGCGCGGTTGCAGCAACAACGCGCCGCCGAGGAGATCTACGGCGAGCGGGAGATGTACATGGCCAAGTTGATGCA
        GCAGCGACAGGGCCCGAATGGAACATATCCCACCCAGCAGCAGTTGCTACAGGCGGAGCGCAGGACACCCGATGCCTATG
        GGCGCTCCAAGCAGCAGCGGCTCTTTGCCGCCGCAGCAGCTGCAGCAGACTACGAGGATATCTACAACATGTCGCAACTG
        GCAGGTGGCGGCGGAGTGCCCATGTCCGCCCAGGAGGCACTTCTCCAGGAGGCGGCCAGCTACCGCAGACCGCTGAGTCC
        GCCCAGCTACGATGGCAGCAAGCATGTGCCCGCGATGCCGCAACGGTACACGCCCAATCATTTGGAGGCCAGTGCCGCCG
        ATCAACTAATCAATACCATGGACTTGCGTGCCCGCACAGCGGCGGCCATAGTGCGTCCCCATTCGGCGGATTTCTTGGAG
        TACGAGGCTCGTGCCGAGGCAGCTGCTGCCGCTGCGGCCGCGGCGGTGGCCCAAAGCCAGCAGGAGAGCGGCAGGGCGCC
        GAGGCCCAAGTCCAGCTTGGACATCAATCGCACACCGGACAGCTTCTACTACTCGGAGGCCAGCTATGCGGACAAGATGC
        GGAAGAGTGCGTTGTATCTGCAGAGCGGCGGAGCTGGTGCCGCACAGCCGCAGCAGCCGGGTAGCTATCGCACCACGGGG
        GCAGATTTCAATTCTGGGGTAAACACCATTGGCTATGAGAATCCCTACGAGCGGGCCTACAAGCGGCAGGAACTTCTGGC
        CGAGGCGCAGGGTGGTGGGGCCAGCAGCATGCCGCGGATGAGCCGATCCGCCAGTCAGGGACGTTCGGTGGCCTCCCAGC
        TGCAGTCGCCGCAGCAAGAAGATCTGCCGCCACTGAATGTTCACCCGGGCTCCATTTTCCCGCCGTCGATGTCCACCCAG
        GAGATCATTAGCAAGAACGAGCAGTTCCTGAGATCCGCTAGCGCCCGTTTGCCCAAAAGATCGGGAGGAATGGATGATGA
        CTATTCGGCTGGCAATTCCACGACCACATCGCCCACGGGTGGAGCAGGTGCCTCCAACTCGCCGCAGCATAATCTGGATG
        GCGAACGGAAGCGGGAGGAGTCCATGAAGCGTCTGCTAGAGTGGAAACAGCGCATGTTGCAGTCACCTTTGACACGCAAG
        GGTATTCAACAGGGCGGCAGCAACATGTCCGCCATGTCCAAGTTGGGCAGCAATCCAAACATCTTGCTGGCATCCACTGC
        GGTGGCCAGTGGAGCACGCTATGCACCCCAGGCGGGTAAAACCGTATTGGTGGGCAATGGAAATGGCACTGCTCAGGGGG
        CTGGAAATCCACCATCAGCATCGGGCATCCAGCGATCGCGATCCGAGAGCCAGGCCAACGTGGGACCTGGGGGAGTGGTG
        TACAACAACTACTCCTCGGATGATGAGGCTGGGACTGTGGATGATGATAACTTGTATAGTGCAACGGCAGGAAGGTCATC
        ATCGTCAAAAACAACAACTAAAGCAACGACATCACAGGCAATAGTGGCAACAACAACAGCAGCGTTAGCAATCACAAATC
        TTGGTAGTAGCAAAAATCTAGAGACACCCAACCAAACAGAAACAGAGGCGACACCATCATCGTCATCAACAGCGTCATCA
        ACCAAAGCGAAATTCCAACTAAAGCCCATTTTGAAAGTGCACGAGGCCAGCAAAACCCGCATTATTCAGGTGCAACCCAA
        ACATCTGGAAGAGCGGCCAAAGCTCAGATTGCAATTGCCCAAGGCGATGGGAAATGAGGAGGAGCAGAAGCAAGAGGATG
        AGGAGCAGGAGAATGTTGAGGCTGAGCCCGTACCCATTCTGCCAAAGAAAACGGCGCCCAAGTCGCCTCAGAATGCCAAT
        TATGTGCCTGTGTACAACAATAAGCTGGTTAGCAACTACGAGAACATGGAGTTTGGCAAGCCAATCCCCGAAAGTAAAAT
        CCCTCACAGCAATGCAGCCATTACCGATCCCGAGGAGACGCCCATGCTAATGCAACTAAAGCTGTTCAAGGAACAGCAGG
        ACCAGCAGAAGCAACAACAGGAAAACGAAGAGGAGGACCTGACACCAACAGCGGAAAGTAAACCCATTCCAGGCGAGGAG
        GATATGGGGGCTCCAAAGGTTATAAAAGACCAGAAATTAGAATCGAACGAGGAGGAGCAGGAGCTGGAGGATGAGGATGA
        CAGCACGGCTTGCGAGGAGTACACAGATGATGATATAGATGAAGCTCTGGCTCAAGATGATGAGGATGAAGCTGTCGTCG
        AGGCAGTAGAATCCCAGGAACTGGCTGAGGAGCGGGAACTGCAGCAGATATATGTTAACGAGCCCATCACACCCACGGAC
        CAACAATTCGACGAGAGTCACTATCTGCCCATGACGCCCAAGAAAGTGGAACTGGGTCAGCCGGGTGTCCTGACCTTAGT
        TTCCGCGACGTACGCCGAGGAGGAGGAGGAGAATCACTATGTAGAGATGACAAAGGGCATACAGGACGAGGATTGTAGAA
        GCAACTACGAGATAATGTGTTTGGCTAGCACCAGTTCGAGTGCCTTCAAGGTGACCACCAAAACGGAGCCTGTCTACATG
        GAACTGGCAGGGGTAAAGGCATCATCCGCAGTGCCAGCCACCGAAGAGGCCCACTGCTCTTCGGGCCGTTCCACTTTAAA
        GAAGTGCAAGAAATCGGGCACTGAAACCCTGAAGAAGAAGACCAAGAAGCGACAGGGCAAGGACATGCCCGATATACTTA
        AGCCGGCCAAAAGTGCCCTGGCCTTGGCCAGCGATAGTTCGGATGCGGATGACGAGAGCAGCCGACAGCAGTTAGAGGCT
        AAGAAACTGCGCTCCAGGTCACGTTTCAGTTTATCGGACACATTTAGGCCAGCTTCTTACTACTTGGGAGCCTCAACGCC
        TCTCAACAATTATGCAGAGAGCTCGGATAGTGAGATATTGCCACCACCACCCATTCCCGCTTCACCACCGCCCATGGAGG
        AGCTGAAAACGGAGGAGATCTTCTCCTCCGAGCACTATGATACTGTGAAAAGAAAGGATAGCAATGGCAAAGTGAATCTA
        TCGTACGAGCAATTGCCCAAGATGCATGCCAGCAATACGTCCCTGAATCTGCCGAAAGCTGTGCCCAGTCCTACTCTGAA
        AAGTAGTCGTCTCTCCTTGCCTGACCATTTCACCAAGGTGCGGATGACACCGCAGAGATTATTGGTTCCAGCCACACCGC
        CGCAGCAGCATCACGCCAGGACATTATCCGACTCCAACTATAGTTGCCAGCTGACCGATACAAGTTCCCGAACATCCTCG
        GATTTGGATCTATATCGCAGGAGGGGTCAACAGCAGAGGTGTACCAGCAATAATTCTCTGCCCTTAAGCAGTGAAAACGA
        GTCCGTGGAATTCCGCCAGAGATCGGACTCCGAATTGGATCGCCAGCGTTCGAGGAGACCACTTTCCCAAGAATCCATCA
        GTGAGATTGAGTCGTTGAGCGAACAGTTTGAGGAAACCCTAAGTAGTCATGAATTGGACACGTACCTGAGCCATTTGCAT
        CTGTCCACCGGTCAGGCCACGCCCACCAGTCACCTGCTGAATGATGCAAATGCGGCAGCCGGAGCCGATATCCTGACCAA
        TCTCATCAAGCCACCGAAAACATTCCGGAATGCCGAGGACGAGGAGCAGCATTTCTATGGTAACATACACTTTCTCTCCT
        CCACGGACTCAATTCAGCAGTTGGGTGAAGCTGGAGCAACGGCATTACGGATTATCCACAGTCGCAATAACAGCAATATA
        TCCACCCAGTCGGCTCCTTATTACTACTCCGAGCTGCCAGCACCGCCGCCCTTGAACAATCAGCGGGATATCCATGCACA
        TGGGCTGAACATTGCCCACATACATAATCCCATCGATCGGCATCAGTTCAATGTGGACGCACTGGTGGACAAGGATCAGG
        CCATCGATAGCAAGAACATCTATTGTGGGCAGAAGGACAACAACGAGAAGCTGAGCAACAAGAATCTCAAGCTGAACAAA
        TCTGTGGATCTGCCGGCAGAGATGGAGGGCAGTGGTAGCAGTGGTGGTGCACTAAACCCGGTGGTCCATTCATATCTCAC
        AACTACTAAAAACACAAATCTCGCTCGTAAAACGATTGGTGGTAGCAATCCGTCGGATGATGGCAATCCTAACGAAGATG
        GTGCTGGTGAAAACACGGAGGAGGCTGGCAAGACCCCGTCGAATAATGTCCATACCAACCTTTCAGTTTTAGGTGGCGAG
        CTGCTCTGGGAGGAGGATGCTCTGTGGCGGGAGAGCTTGCGTCGGGTGTCCCAGCGGCATGCCAGATCCTTGGACGATCT
        GGACAGGATTACGGCTGCTCCACCAATTTCTAGTACGCCCAAGGCAAAACTGAGCCGCGAGGTGACCTATGTGAATGACA
        GCTTGAAGCCGCGCCAGCATCCGCACATAACCAACGAGCATGATGTCTATGTGCAACTGATGGACACTACGTCCTCCTCG
        CACGACCACGACCAAACGGATTCCGATGTCTACGAGGTCCTGCGGGAGGAGACCGCCTCGAATTTGTCACACAAATCAAA
        CGAACTGGATCGCGAGACCATCCGTCAGTGGGATGCCATGTCGAGTGGCCTAATGAAGAGCAACCACAGCGGAGTTGAGG
        CTACAGGAGCTAGCTCTGCCCACCTGCCCCTAACCAGCAGTGTGCGCTCCATAGTTCAGCAGTTGAACAATAGTTCCATG
        GATGATGCCAATGGCAATCCCATGGCGACGGCCTCGATTTCCGTGCGCAATGTGAACAATCTGCCGGTGGGAAATCTGAC
        GGTGAAGCCGGATCCCTCGGATGTCCATCAGGAGTCCGCTTTTGCACCCTACTATGGTGGAGCGGCGGAAACTAAGTACG
        CCAAGAATACGGTGCTCACGGATCGCGGTCTGTATGCCGCAAACGGATCTGGATTGGCCACATCCACGCCCCAAAATCAT
        CAGCAGTTCCGGATGCGGCACACCGGAAGTAGGGCGGAAATCGATATGCTGGAACGCGAGACAAGCAGTCAGATCAGGAA
        TCGCCTGCGAAGTGCCGAGGGTTTGACCAGAGCCGAGAGTATCCAGCGTTTGGACTACTTGAAGCAGCACCTTTTGGACC
        TGGAGCGGCACTACGAGAAGAGCAAGCCGCTGGTCAATTTGGTGGACAACATGGTCAAGTTGGGCTCACTGTATCGCAAC
        GATGCAAACGGCAGGGTCCAACCAGCCACACTGGATCGCCTGGAGTTCAATCAGCGGATGCAGGAGCAGCAAATGCTGCA
        AGAGGAGCAGCAGCAGTGGGAGCGTCTCAGTCCCAATCAGGCAGAGTTGCAGGTGCGTGAGCTCTACCAACTGGATCAGC
        TGCTGCAGGAGGAGTCGGGCACTTTGCAGAGTTTGCAGCGGGACAAGGAAGATCTCGAGCGAGCCTTGGGAGGATTGAGG
        GCTCGCATCCACGACAGCAATGCCACGCCCATGGCCCTGGAGGCGGCCAAGAAGCAGCAGCACATCCTGGAGCGTGAGCT
        GTCGCGGGTTCATCAGCTTCTGGCCGAGAACTCTAAGAAACTGGAGCAGACAGTGGCGGGAAATGCTCGCCTGGAGCAGG
        AGTTACTCCTTCTCCGTCAGAAGGTACAAGCCGTTCGAGGATCCACCACCAATGGAATGAACGGTGATGGCTCTCACATC
        AATGGTGACCAAACTGCCGCCGTTTTGGCCTCGGAATTGGAGCGAGTGCAGTCCCTGGTGGGCGATATGCAAAGACAACG
        CCACGAACTCAGCTCCGCAGTTCGCCAGCTGACGGAGAACTCGACCAGGTTGTACCAGGAGATTGGTAACAAGGAGATGA
        ACGGCGGTGGCTCCACCAATGGCAGTCTGAAGAAGCGAAGCAACTCAACTAGTTGGACGGAAACCGATTTGGATGCTAAT
        ATGCTGCGATGCGGATCCCGCCAGCAGTTGAATGATTCCACTTTGAACCTATCCACTCCCCTCTATGTGGACACCAATAG
        TTCGACCAAACTGAGTGACTACAATCGATACAATGGCAGTAGCGATGCCATCGAGATGAGTGGAGTGGACAGTGATGGTT
        TCCTGGACAGCAATCCATTCGCGCTGGGCTTGGAGAAGCAGGAGATTAAGACAGTGAGGATTGTCAAGCGAGAGTCTGAA
        CGTCGGAATCGCGATCGCAGTGAAAGGGGTCTAAGCAACTCCATTCAGAATCTGGATCAGGTCCTGGAGGAGGAGCAATA
        TGCCCAACAGCAGAGGGAACAGCAGCTGTACGCTCAAAACTTGGAAGAACCGATGACCAACGGGCACCACAGTCGATCCA
        AGTCATTGCCCCGAAACTACAGTGAGCCCCCGAAACAACGACACAGTCGTCATCTGAATGGTGGCAAGCAGAATGGTCAC
        CACTATAATGGTGGCTACGATTACGATCGGAACAGCAACTACGAGCATCAGCCGCCACCACCACCGGCACCACAGAGCAA
        TGGTCATCACCACAATCATCAGCAAAGGGAGCAGCGGGAGCACCTTAATCCACTGGCCAATGCCTATTTCGCCAAGCAGC
        TCCAGCAGCAGGCGAATCCCTCGAGGGACAGTGCCCGCGTGGCCTTGCGGACCAAGACCGATTCCCTGCAGAGCCTCAAC
        AAAAGCCTTACGGACATCAGTCCGGAGCCAGTGTTCCAGAGCGTTGCTGCCCGCCAGATCATCAACGAAATGTCCGCCGG
        TTCGGCATCGGAGGACACCGAGAAGGTGGTGGAGAAGGTGCCACCGCACCACAAGCATCGCAGAGCGGTTCCAAGGGAGA
        AGAGGCGACACTACACTGCGCCAAACAATGTCAATCAGAAAGCCATGGAAAAGGTGCAGGCCGAAAACGATATGAATCGA
        AATAACACCAACTGGAGAGCTCGCGATGATTTGGATATGGAGGTGGCCCTGCGACCGCGAATGAATGCTCCTGATGTCGT
        TCGTTCTGCTTTGGGACAGGGCGAAAAGATATCCGAGAACACCATAGACAATTTGCTGCTGGCACCGAACAAAATAGTCA
        TACCCGAGCGTTACATACCTGAAACACTGTCGCCGGAGGAAAAGAAGCGTCGTCAGGAGAAGGTCGAGTCCATCAAGAAA
        ATGCTGGCTGAGGCGCCCATTAGCAGCAATGAAAACGAAAGCCTGCCCCCGAGCAAAATCAACGCCGAGAAGAAGCAGCG
        CGAGCACCTGCTGCAACTCAACCAAATCCTGGCCCAACAGGTGATGCAAGTCAGCAAGATCGTGGCCGGAAATCCCACTA
        GTCACAACTAATTTGCAAGTAGCTTGTCGAGTTGTTTCTGTTCACCTTTTGTGTTTTACATACCTATGCATTGCATTTAA
        CTTTTGTTCACGTTGTGTGTTTTTTTTTGCCAATCTGAGAGGGTTCGCATAACGATACGCGGTAAATGAGTTTGCTGTTC
        GAAACATACCAAACATATATATGCATAACTAGTACGATACACCTAACTATACAGTAACTACAGCAAACAAGAACACACGC
        GAAGTTGAGATTTACAGCATGCTAAACTCACATAAAAAACTCACCCAAATCAAACGCAACAGCTCACAACAAGAATACT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0112622
        7637
        FBtr0112623
        7109
        FBtr0112624
        8745
        FBtr0290011
        7037
        FBtr0329897
        6710
        FBtr0329898
        9067
        FBtr0334567
        10048
        FBtr0334568
        9215
        FBtr0334569
        6840
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0302933
        3090
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0111534
        1974
        FBpp0111535
        2020
        FBpp0111536
        2050
        FBpp0288450
        2020
        FBpp0302931
        2042
        FBpp0302932
        1974
        FBpp0306634
        1308
        FBpp0306635
        2020
        FBpp0306636
        2037
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        GC splice donor site postulated.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG34383-RI
        kmr-RI
        Secondary FlyBase IDs
          References (0)