Open Close
General Information
Symbol
Dmel\rl-RG
Species
D. melanogaster
Annotation Symbol
CG12559-RG
FlyBase ID
FBtr0329919
Feature type
Associated gene
Evidence Rank
Length (nt)
2347
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 14 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ATATTATTAATGTTTTACGCCGTCGATTTTGATAAATCATATTTACGCATTTGTCTAAAGAGTAAAAAAAATATTTCAAG
        TTTTCCAGAAGAAACGTTAGTCATGGAGGAATTTAATTCGAGCGGATCAGTAGTTAATGGTACAGGATCTACGGAAGTTC
        CTCAATCTAATGCTGAAGTTATAAGGGGACAAATATTTGAAGTTGGTCCTAGGTATATTAAACTCGCCTATATAGGTGAA
        GGAGCTTATGGCATGGTTGTAATGTGCATAAATCCTTAATGACGAACATTTCTTGGACCTAATCCATCTTGGGACTGTTG
        GAGAACATCTATGGAGTCTGCCTTAGTTATTAGGTCTGCGGATGACACGCTAACAAACCAAAGAGTTGCAATAAAAAAAA
        TATCGCCCTTTGAACACCAAACTTATTGTCAAAGGACTCTCAGAGAAATAACCATATTGACCAGATTTAAACATGAAAAC
        ATTATTGATATTCGAGATATTCTTCGAGTTGATAGCATAGACCAAATGAGAGATGTTTATATTGTACAGTGTTTGATGGA
        GACTGATTTGTATAAACTACTTAAAACACAGAGGCTAAGTAATGATCACATCTGTTACTTCTTATATCAGATATTGCGTG
        GACTCAAGTACATTCATTCCGCAAACGTCTTGCATCGGGACCTTAAGCCAAGTAATTTACTGTTGAACAAGACGTGCGAC
        TTAAAAATTTGCGACTTTGGATTGGCTCGTATTGCAGATCCCGAGCACGATCATACTGGCTTTCTCACAGAATACGTTGC
        TACCCGATGGTATAGAGCACCTGAAATAATGCTTAACTCAAAAGGATACACCAAATCTATAGACATATGGTCCGTTGGCT
        GCATTTTGGCTGAAATGTTAAGTAATCGGCCAATATTTCCTGGAAAACATTACCTGGATCAACTTAATCATATTCTTGGA
        GTATTGGGTTCACCGTCCCGGGACGATTTAGAGTGTATTATTAATGAAAAGGCACGGAACTATTTGGAATCTTTACCATT
        TAAGCCAAATGTACCCTGGGCGAAACTATTTCCAAATGCTGATGCGTTGGCTTTAGATCTCCTTGGAAAAATGTTAACAT
        TTAACCCGCATAAACGGATTCCTGTCGAGGAAGCTCTTGCACATCCCTATTTAGAGCAATATTATGATCCTGGAGATGAG
        CCTGTCGCTGAAGTGCCATTTCGGATTAATATGGAAAATGATGACATTTCTCGAGATGCCCTGAAGTCGTTGATTTTTGA
        AGAAACCTTAAAATTTAAGGAACGACAACCAGACAATGCGCCTTAAGAATGCGCTGTAAGCTTTAAGAATTTGAGTATAT
        AGTAAAACAATTGCTCCACTTCTCCATTAGCATAACTTTTTTCGTAATTTCTCTATGTTTATTTAGATTAGGGCTTTAAC
        ACAAAAAACATACTGAAATGAGACAAACTCCGATTCTTACATATATCCTAAATAGCCCTAATTATTTTCTAAAGATAGGA
        ACTTAAACTATGTGTGATGTTCGTAAAATGCAAAACATTTTTTTATTTATTTTAAAAGTACCTAATAATTAGGCTACCTG
        ATGTAAGAAACGTGTATTATATTGAGATATTATTCGCGGAATATTAAAGATCGATTAAAGAAAGTAAAGAAGTTTACCAA
        AATAATCAATCAAACTATGTAAATTTGTTTATTCTTTATTTGTTTTAGATCTAAATCCAAAAAAATCTATATCAAGCCAA
        ACCCCCCATTTTTTGATTTGTGTAGTCATAATCAATATAACCATCTTTGATATATAATTAAGATGTTCACATCGCGTCAC
        TATTTCCAAATTCAATTGATGATAACAAATTGTTAACAGAATTATGTATGACCAACTGGCATGATAATATAAAATAATAC
        AGTTATATCATAATTTAATGTGATTTATCAAGACTAGCAGGGTAAACCTTCCTTGGATGTTTAAGTGATTAAGCTAAAGA
        ATATTTCGAAATATGCCATAACACGAACGGTACCAAATTTAAAAATGTCTTGCTATTTAATGCAAGACATAAATTTGAGA
        ACTAACGAATTTTTAAAATACGTTTAATTTTTTTTTCTTGTGTGGGGTACATGGGACTTTTCTAAATTTGAAAAATTTAC
        AACTCTGTTCTGATATAAGAAAAACTAATACACCGAAGGATAGATTTTCCGGGTAGATTTTTACTTGTTTCCGAAATTCA
        AAGACTTCACATTAATTAATAGTTGCGCACAATGAAATAATATAAAAATTATAATTAATATTATCACCTAACGAAATTTA
        AAAGCAAATATTAAAAAATTGTAATAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0113701
        1412
        FBtr0113703
        1614
        FBtr0113702
        1795
        FBtr0113700
        1573
        FBtr0329920
        6472
        FBtr0345337
        2072
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0302952
        331
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0112424
        190
        FBpp0112426
        376
        FBpp0112425
        376
        FBpp0112423
        376
        FBpp0302953
        266
        FBpp0311493
        376
        Comments

        GC splice donor postulated.

        3' UTR based on RNA-Seq data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        rl-RG
        Secondary FlyBase IDs
          References (0)