Open Close
General Information
Symbol
Dmel\PEK-RC
Species
D. melanogaster
Annotation Symbol
CG2087-RC
FlyBase ID
FBtr0330027
Feature type
Associated gene
Evidence Rank
Length (nt)
4169
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 30 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TTTCTTCAAAATCTTGTGTTTGTTTATTTCAAGCTCGCCCATGGTAATTGGATATTACCTACATAAAGGACTCCTATACA
          TTTCCACGCTTGATGGTCGACTGAGCGCTCTGGACATCGCCAAGTCCGGCAAACTGCGCTGGAGTGTGCCCACCGGACCG
          GGGCCACTAATCTCGTCCAGCATCCATCGATTGGAGCTGACCAACAATGGGCAGTTCGTACGCATGATTCCCTCTTTGAG
          CGGCGGCATCTACAAGTTCGACGGGGACTCCATCGATCCCATTCCAATCACGGCGGAGCACCTACTCAGCTCGAGCGCCA
          AATTCAGCGATGATCTGGTTATATCCGGAGGCAAGGAGACACGCTCATACGGTGTTTCCGTTCGCACTGGCCAGCTGCTG
          TATGAATGTTCTCTAAACGGATGTGTAAACTCTACGGAGGAAGGGCTTGCAATCGACGACACCATTAGGGAGCCCGATGA
          GGAGGATCAGCTGGAGGACGGAGAACAGTTAAGGGACGAGGCCGGCTACATAGTGCGCCATGATCCTCTCCTTGACGACG
          TTATTATCGTCCGCCGCCAGACACAAACGGTTCGGGCCGTGGAATCCCGGACCGGAGTGGAGCGTTGGAACTTTAGCGTA
          GGTCAGCATGAGTTGGATCTGGTGAGACCTTCCGAGTGCCAGCTACAGCCGCGCGATGAGCTGGAGCTGGCTGTTTTGGA
          TGTGGATATAAAGGTGGTAGTGCCCGAGGGAATTATCTGCGCCTTCAGCAAAAGTGAGCCACAGACTATGCTGTGGAAGT
          ACAAGTTTGATCACCCAATTGTGAGTGCCTGGAATACAAATGCCGACGACGAATTGCAGCCTATTGATTTGTTTAGCTCG
          GCCCAGTGGCTTTGGGACCAGGACGAAAATGACACGGAGCTGCCCAATGCGCCACAAAGCCCGCCATCCATCTACTTGGG
          CATGTACGATAAACAGTTGTATATTCAGGAGTCAATACGTCTACGCCAGGAGATTATGGACCAGACCAAGGTCTATCAGC
          AGCTTACAGGCGACACCAGCCTGATGCCCAGGATTCCCTGGAAGCCGATATCCGCCAGTAGCAAATCGCTGGTAATCTTC
          CGGAAAGACCAGGAGGACCCTGAAATGATTGCTGAGGGAGCTGTGGCACAAGGAGGGGAACTGGTGCCCTATGATGATGA
          AAACTTCGCTGTGGCAGCGCAGTCCGTATTGAATGCATCGGAGTTTGTCAATGGCAATGGTTTTTACTTCTACACCACTG
          GCGATCTGAACGGCCCGCAAGAGTGCAGTACGCAGAATAATCCAACTGACCTTCCAGCAATCACAGCTCCAACATCGCCT
          ACCAATGCCACATCTGAGGGAACGGAAGCTACTGGAAACCATAGCGTCAACGACGATTTGGGCTTTAGTTTGGATGACAT
          TGATGCGCCTGTAAAGGTTGTGATATTGTCGTTGTGGTTCTGGTGGAAGGAAATCGTGGTCATAGCATTTACGTCGGCTG
          TGATTCTAAATATTTTCATGGGCCAACGAAACCAGCGCGTGGAGCGAGAGTATCTGGTCATTGAACGTCATGTGCCTGTT
          CAAACGGCCATCGAGGCCACCGAAGCATCCACACAGGCTTTACTAGGTCCAGTGGTGCCGATGCAGCGACCTGGAAATCG
          TTTTAGCTTCCCACCTGGACAAGCAAATCAGCGCACCATTTCGGAGTCTACAACTCATTCAGGCGAGCATTACACTTCCC
          GCTTTCAGTCCGACTTCGAGTTGATGCAGTGCCTTGGTCGCGGTGGTTTCGGAGTGGTCTTCGAAGCTAAGAACAAGCTG
          GATGAGAACCGATACGCCATTAAGCGCATAACGCTACCCAATAAGGAATCTTCAAGACAGCGAGTCCTTCGCGAGGCTCG
          AACTTTGGCTAGTTGTGAGCACCACAACATCGTGCGATACTTCCATTCCTGGACCGAGACACCGCCGACTGGTTGGCAGG
          AAGAAGAGGATCGCAAGCTGCTTGCCCACGAGCTGTCCACCTCTATCCAGATAGAGACGCCGGACGATAGTACAATGCCT
          TCGTTGACGGAGCAGTTGAAGGAGAAACGCCAACAGCAGCTCTTGTCCTGGGTTTCGGATGCAGCCAATAGCACCGCTTG
          TAGTCACGACTTTCATCTACCAGGCGAGTCATCACTCAAGAACATACGCGAGGAGTACGACTACGATGAGGAAGAGGACT
          CGCTCATTGAATTCCGCAGCGAGTCGCAGTCAGCCGCTTTACGGGCAGAGGAGGAGGATGATACCGACGACGACTATGAA
          GAGGATGAAGAGCAGCAGGGAGACCATGAGAAACGACATCGCAGCTCCGTGTCCATTGACATCCATTCGGCCTCGTTTGA
          CCTTAAGAACATAAACTACTCACAGCACCAACTGGTCTCCAATTCGTTTCAAATCGAATCTGTGCGCCCCAAGAGCAGTG
          GAAGTGATGATGCGAATGACGATAATAAAGCTAGAAGGAAGCCCCTTACCTTGGCACTGGCCCAGAATCACAATAACAAC
          CAAAACGGGAGCCAACCTACGCCCTCCAGTGCCACGATTCTGAACGGAACGGTGGCCAAGCCCAGCAAGGTGTACCTCTA
          CATCCAGATGCAGCTATGCCGCAAGGAGAGTCTGCGCGACTGGTTAAGGGACAACCGGTCGGAAACAAGGGCTGCCCACA
          TTGGTGACATTTTTCACCAGATCGTTGATGCCGTTGACTATGTACATTTGAAGGGTCTGATTCATCGGGACCTGAAACCA
          AGCAACATATTCTTCTCGCAGGATGGACAGATAAAGATTGGAGACTTCGGGCTCGTCACCGACATGGCCGATATCCCCAA
          CCTGGTGGCCAAGTGTGGGGACCAGAGTGGCCTGCCCTCCTGTGCCCGCCACACCCAGCAGGTGGGCACCCACTTATACA
          TGTCGCCGGAGCAGCTTTTGGGCCAGCACTACGACTACAAGGTGGACATCTATTCACTGGGACTGATCTTCTTCGAGCTG
          CACGTGTACTTCAGCACTGAAATGGAGCGGATCAAGACACTGCGCAGTCTTCGGGACGGCCAGTATCCCAAGGATTTCGC
          TGTCAATTACCCGCAGCAGTACGACTTGCTCCAGCAAATGCTATCCGCCCAGCCAGAGCAACGCCCGCAGACCAAGCAGT
          TGAAAAGCCAGCTGCGCAACATTCTGCAGCTACCTCATCTCCTCTCGGAAGGACAAAGCGAGCAGGCGGAGCTGGCGGAG
          CGGGCCAGGCGCCTGAGTCGCAGCCGCACCTTCAGCAGCTCCAGTGAGCCGCATCAGTGATAGATCAGACAATTTGGGCC
          ATGAGCTTGGACACCCATTCTGTCAGCGCCAAACTCAGTCACTTATAGCATTTCGCTTGTGAGTCATCAGTATCGCCATC
          GCTTATTCCTTACCTGGCTATGCCTTATTCGCTGACCTCGACCCGTAAAGGTCGCAGATTCATTACCGGGCAACCCTAGA
          TTCAATAAGTTTTGTATTACGTTTACCTTTACTCTTGCGCGTCGCAAATTACCAACAAAATGTCCTTTTGTTTTTAAGAC
          TTAACCTTAGGAATTATACATACACATAAAGATGTACTCCTAAACAGTCGTTAGCCTAAGTTACCTAAGTTACCTACGAT
          GCTAAATTGTTTGTCTTAGTTTGTTTCTACCCATGTAGCCGCCCAACCAATGCGAGAGTTTGTTTTTAGTCGTAGGCGAT
          AAGATTAAAATAAAAATGTCAAAAATAGAAATGGAAATGTTTTCTAATTGCCCATAGAGATAATGGTTGTGACTAATCGC
          TTGGCATACCTTAAAGCAGTCGCCGCATGCGGCAACATTGTGTGTAGTAATGAAATTGGTTGAGGCGCTGAAAAGTCTTA
          CATAAATGATATACGCAATAGGCCACTAAGTAATTGTGTACGTACTTCTGATTGAGGGAAGTCGCAGAGGTGATGAAACT
          CATGGTTAACAAAATTCTTGTCATTTTTTTGTTAGCTGTTGTTGAATAAACATTTTTTTACATTGAGCTATTTATAAAAA
          ATTTAAGGATTAATATTAGAGCCAAAATAGTTTACTGTTAAGGAAAATAGGCAACTTAATAAAAATCAAGGAAAAATTCC
          ATTCCCATG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0078770
          4639
          FBtr0330026
          4265
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0303060
          1099
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0078417
          1162
          FBpp0303059
          1110
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          PEK-RC
          Secondary FlyBase IDs
            References (0)