Open Close
General Information
Symbol
Dmel\CG4562-RC
Species
D. melanogaster
Annotation Symbol
CG4562-RC
FlyBase ID
FBtr0330034
Feature type
Associated gene
Evidence Rank
Length (nt)
6512
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 1 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TGCGCAGATTCGACGCGCACGCACTGGAACTTGTTTAACGTTTTTATGTTTTTCACTGCACAACTTTGTAAAATCAGCAC
          ACGACATTTAACACAGCGCACAATTATTTCCGTGTGTCCTGCGGGAGGGGAAGGACACGTTCACATTCATCAGCACTGAG
          AAGGAAAAGAGCACCACAGTAGGAGTCCCGTTTGTTGTCCTATTGATTTGCCCCCACTTTTTGGAGTTTTTCGTTGTTCC
          TTTTCGGCATCCACCGCCCCCGCTGCGCCCACGAAAGACAGCGGCACCTGTACAGGATACACGTACACCCCGACCAATGA
          CCTGGCACCTGAAGCTAGGGAATCGATAGAATTAGACCAAACCGACCAAGATGCAGTCAATGAAAGCCGATGAACTGCCG
          GAGAATCCGCGCGAGAAGTCCAACATCTTCTCATCTTTGATGTTCTGCTTTGCCATGCCCACTTTCTTCAAGGGACGCAA
          AAAGACACTGGATGAGAATGATTTGTACCGCGCCTTACAGGAGCACAGATCAGATCACCTGGGCAGCAAGCTGAGCGCGG
          CGTGGGAGAAGGAGGTCGAAAAGAAGCGCAAAAAGAAGAAGACCCCCAGCCTGCTGAAGGCCTCGATGAACGTGTTTGGC
          TGGCGCCTGGCCGGTCTAGGCCTGGTCCTCTTCATCTTGGAGATCGGTTTCCGAGTCACCCAGCCGCTGTTCCTGGGCGG
          TCTGGTGGCCTACTATGCGGACGCGAGCAACCAGGAAGGCGATAACCAGACGAAGGCATACCTCTACGCCCTGGGCGTGA
          TCTTGACAAGCGCCTGCAACGTGCTCTTCATGCATCCCTACATGCTGGGCATGTTCCACATCGGCATGAAGGCCAGAATA
          GCCATGACAAGCATGATATATCGGAAGGCGCTGCGATTGAGTCGAACGGCGCTGGGCGATACCACAATTGGTCAGGTGGT
          CAATCTCATCTCGAACGATGTGGGCCGGCTGGACGTTTCGGTCATCCACATGAACTATTTATGGCTGGGTCCGGTGGAGA
          TTGGCATTATCACGTACCTCATGTACAGGGAGATTGGTATCTCCGCCTTCTTCGGCGTGGCGGTGATGTTGCTGTTTATA
          CCCCTGCAAGCCTATCTGGGCAAGAAGACCTCCGTGCTGCGATTGAAAACGGCTCTGCGGACGGATGAGCGAGTGCGCAT
          GATGAACGAGATCATTTCGGGCATCCAGGTGATCAAGATGTATGCGTGGGAAATTCCCTTCAGCAAGATGATCAACTATG
          TGCGCACCAAGGAGATGAACGCCATCCGCAATGTGAACTACATCCGAGGCACGCTGCAAAGCTTCATCATGTTCGTCACG
          AGGATATCGGTGTTTGTGAGCTTGGTTGGATTCGTGCTGCTTGGAAAGCTTCTGACCGCCGAGAAGGCCTTCGTGATCAC
          CGCCTACTACAATATCCTGCGTAACACCATGACCGTCTACTTCCCCATGGGAATATCCCAGTTTGCCGAACTATTGGTCT
          CGATCCGCCGTATCCAGACATTCATGCTGCACGAGGAGACAAAGGTGCGTGACAAGTCGGAGGACCTGGACGAGCAGAAG
          CTGGGCAAGGCGGGTCTAATTGCTGAACCCACAGTGGCCCAGACCACTGGTGTCCTGAAGCCAAGCAGTCGTCGCACCAG
          CGAAGCGGAGCACAGTATCGTCATAAGCAAGCTAAAGGCCAAATGGGATCAGAAGAACACGGACAACACGTTGGATAACA
          TTTCGCTAAAGTTCAAGCCGCGTCAACTTGTGGCCGTCATTGGACCAGTGGGCTCTGGAAAATCAAGCTTGATTCAGGCT
          GTGCTGGGAGAACTGAATCCGGATTCTGGTTCGGTCAAAGTCAACGGAACTCTCTCGTACGCCTCCCAGGAGCCGTGGCT
          CTTCACCGGCACTGTTCGCCAGAACATCCTCTTCGGACTGCCCATGGATAAGCATCGCTACCGCACTGTGGTCAAAAGGT
          GTGCCCTGGAGCGGGACTTCGAGCTGTTGCCCTATGCTGACAAGACTATTGTGGGTGAGAGAGGAGCATCTCTCTCCGGA
          GGACAGAAGGCGCGTATAAGTTTGGCCAGAGCTGTTTACCGGAAGGCTGACATCTACCTGTTGGACGATCCCCTTAGTGC
          CGTGGATACCCATGTCGGACGTCATCTGTTCGATCAGTGTATGCGTGGATTCCTGCGCGAGGAAATCGTACTGCTTGTGA
          CCCATCAACTGCAGTTCCTAGAACAGGCCGACGTTATTGTGATCATGGACAAGGGCAAGATCAGCGCTATGGGCACCTAC
          GAGTCCATGGCCAAGAGCGGTTTGGACTTCGCCCAAATGCTGACGGATCCCAGCAAGAAGGATGAGGGTGCCGGTGATGC
          CCCGGACAAGAAGAGCCTCTCGAGGCAGAACAGTAAATTGCGCGACCGACACGGTAGCATCTCCTCCATGGAATCTGCTG
          CCGAATCCTTGGCGGCGGAGTCACCCATGCAGACGCAGGAAGGTCGCGTCGAGGGGCGCATAGGAATGAAGCTCTACAAA
          AAGTACTTTGGAGCGAATGGCTACGGACTGTTTATCGTATTTGCGTTCTTCTGCATTGGTGCCCAGGTGCTGGCCTCTGG
          TGGTGATATCTTCTTGTCCTACTGGGTGAACAAAAATGGTGAAGCTGAGCGTGATACCTTTATGGCCAGATTGAGACGCG
          CCTTCCCCGAAACCCGCATCAATGCCGATACCGATCCTGTTGACATCTACTACTTCACCGGCATCAATGTGTCTGTGATC
          ATCTTCTCGCTGGTGCGGAGCATGCTCTTCTTCTACCTGGCAATGCGCAGTTCGACGACCCTGCACAACACCATGTTCCA
          AGGTGTGACCCGAGCGGCGATGCATTTCTTCAACACCAATCCCTCCGGACGCATCCTCAATCGCTTCTCCAAGGACTTGG
          GTCAAGTGGACGAGATTCTTCCCTCCGTGATGATGGACGTGATGCAGATCTTCCTCGCAATCGTGGGCATCGTAGTCGTC
          CTATGTATCATTAACGTTTGGTACATCCTCGCCACGGTGTTCCTTGTGATCGTTTTCTACCTCCTGCGCGTCTTCTATCT
          GAGCACATCCCGTGACGTGAAGCGACTCGAAGCTGTCACACGCTCCCCCATTTACTCCCACTTGAGTGCTTCCCTTAATG
          GCCTGGCCACCATCCGAGCATTTGGAGCGCAGAAGGAACTGATTGCCGAATTCGACAACTACCAGGATATGCACAGCTCT
          GGCTACTATATGTTCCTTGCCACGAGTCGAGCCTTTGGATACTGGCTCGACTGCGTTTGTGTTGTCTACATCGCTGTAAT
          CACATTGAGCTTCTTCCTCTTCTCCCCGGAGAACGGAGGTGACGTCGGTCTTGCTATTACCCAAGCCATGGGCATGACCG
          GTATGGTCCAGTGGGGAATGAGACAATCGGCCGAGCTGGAAAACACAATGACGGCAGTGGAGAGAGTGGTGGAATATGAG
          GATCTTGAACCGGAGGGTGACTTCGAATCCAAGCCAAATAAAAAGCCGCCAAAGGATTGGCCAGAGGATGGAAAGATCGT
          GTTCGACGACCTCTCGCTGAAGTACTTCCCCGACAAGGCGGCCGACTACGTGCTCCGATCCCTGAACATCGCTATCGAGG
          GTTGCGAAAAGGTGGGCATTGTGGGACGAACTGGTGCCGGCAAATCTTCGCTGATCAACGCTCTGTTCCGTCTGTCCTAC
          AACGAGGGAGCCATCCTGATCGACAGGCGCGACACCAACGACCTGGGACTGCACGATCTGCGCAGCAAGATCTCCATTAT
          TCCTCAGGAACCGGTGCTGTTCTCGGGCACCATGCGTTACAATCTGGATCCCTTCGACGAGTATAGCGACGCCAAGCTGT
          GGGAGTCTCTGGAGGAGGTTAAGCTTAAGCAAGTGGTGGCTGATCTTCCCAGTGGTTTGCAGAGCAAGATATCCGAAGGC
          GGCACCAACTTCAGCGTGGGACAGCGACAGCTGGTGTGCCTAGCTAGGGCCATTCTCCGAGAGAATCGCATTTTGGTGAT
          GGACGAGGCAACGGCTAACGTCGATCCGCAGACGGATGCTCTTATCCAGACGACGATTAGGAACAAATTCAAGGACTGCA
          CGGTGCTCACGATTGCCCATCGATTGCATACGGTTATGGACTCGGACAAGGTGCTAGTAATGGACGCAGGAAAGGCGGTG
          GAGTTCGGATCTCCGTTCGAGCTGCTCACAACCAGCGAGAAGAAGGTCTTCCACAGCATGGTGAAGCAGACGGGAGACTC
          CACTTTCGATGCCCTGCTGAAGGTTGCCCAAAAGGTGGGATTGCGTTTTAAGATTCAATGTAACTTGTCCACATGCCTAA
          GCTCTTTGTCTTCCTTTCAGGCCCATGATGACAACCTGCGGCTCAAGAAGGATTCTTGACATTTCGCCGTTCCGAAGGCT
          TTTAAAGACTACATACTTAAGATACTGGAACCAATTACGAATCATCCGGCGGCCAATGCGGGCATTCAGAAGACCTTCCT
          CTTTGCGGAGGCCTCCAAGCAGAAGTTGTTAGGATAGCAAGCCATCAGCGGCGCCAGCAGACATCCCCACTGAGCTGCCG
          CTGAGAAACTTTTTACAAGACGTGTACAAATCAAAATAATAGTTAGTCAGGTGTATAAAACTAGGAAACTGATGAGAAAT
          CAAACAGCAAGACAATAAGCTGATGTTAGAGGAGCGTAGGGACTAAATGTTTTTGTACCTTAAAAAAAAGAAAGATTGAT
          ATAAACTGCAAATTGTGCAATAATTAATTTTAGCTGAACTTTGTGCATTGGCCTTCAAAAGGTCGCATTGCATTTGTATT
          ATGTGTTCCAGTAAAACGACAATAACAACCTTAAAGAAAAAAAAAACCCAATGAAAAGCCCCAAAAAAAGAAAAAACTAA
          AAGAGAATTCTATGAAATGTTACGCCTAGTATAAATATATGAGTGTTTTTATAGTAATTTATTAATGTACAGGTATACAA
          TAAATGTAACAGCTCGGTTGGTTCTTTTGTTAAAACGTTTTTATTTGTTTTATTTCATTATAACGATTTAGCGACTTACA
          TTAGCCTGCTATATACACTAAGAGATTGTACGCATTTAACTCAAAAGTATCTTCCATTAGCTGCAAAGCCCTCACTATAA
          TTATTGTAAATAATGGCTAAAAGCGGATATAGTAACTCATATTTAGTTGATGTTGTATTATGTTAGATGATGTTGTATGT
          TAGAGTTGGCTTAGCTTTATTTGCCTCTGCACTAAATTGCAGTTCAGCATGTGCTACATGGAATATAGATAGGTGGCCTG
          CCCCGCGCATCCTACAGGACCAGCGACAGCCACGCGGCCATCAGGCAGAATCCTCCGACGGTCGCGTACGGTTGCAGACG
          CTTCTCGCCAGTCAAAGCGCGGTAGTACATGCAGCCGCTGAAAAGCATCATGCCCGTAATCATCAAAGTGCCAGTCTGCG
          GGAGGAAATAAACCAATTACTTTAAGTAACCACAGTCATTTGGGCCTGTTCCAAGCCCCACTGTTCTCGAAATCTATATG
          AAAAGCTAAGCACGACTATTGTAATTAAACGATTTTAGGATGCAAAGAATTTATAGCATTTAAATGTTTAGTCAGGAATC
          AAGATATACATATGTAAGAAATTCCAAATTGCAAATAGTTTACCCAAAATTTAAGTCACATTGTTATCTAAATGCATTTA
          CATTTCTTAATCAGAAAACTCTAAAACGGAACAGGCCCTATAGTTTATAGTCTAGGAGTAGAAGTTTGCGAAGATGGCCA
          GCGTTTTGAGTGCATATTTGGTGTTAGCTTTAGTTGTTAGCTTTAAAACGTCGACAAAACGGAGCTCGATAAAGCCCAGA
          TTTTACTTATTAAATAAGGCTGATGACAACAAATACCAATTACAAGATAACAGCAAAAACGAGAAAATCTATGCCTTTTT
          GGTACATTTTTAACATACGATTGTAATTATGAAGAGAGTAAATCAACAAATTCCTACCCAAAACCCCGAACCCATATCAG
          CTATGAACCTGCTCATATCACAAACCTAAGAGTTATCCGAATTAACGCAATTATTATACAAGTATCGTGTGTGGTATTGA
          AAATTACTTTGTAAGCTGCAATTAGTGGTTGTTGAACATTTAGCTTTAGCTTTGGAAACATTTCATATACAACATAAATA
          TACATATGCATACCTATATTATAAAGAAGTAACTTGGAGAAAGCGCTTGGCTCAAATCAATATTCATTCATAGCTCAATT
          TTGTAATGTCAATCAGCGCATTAGACTAGCTAAGCAGAGAGTCAATTATTCGAGTATCAATGTTGGAGTTTCGATTCGAG
          AGTAACGCGAGTTGTTATAAATTCCGTTCAGAGATCTAACTTTACACAGAGTTTATGTAAATGACAAACCAACAAAGAAA
          GCTTTACAAATAAACCAAATACACGACCGAGA
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0083859
          4825
          FBtr0113250
          4539
          FBtr0330035
          4764
          FBtr0330036
          4825
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0303067
          1362
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0083268
          1362
          FBpp0112162
          948
          FBpp0303068
          948
          FBpp0303069
          1408
          Comments

          Extended 3' UTR based on RNA-Seq and/or EST data.

          5' UTR based on RNA-Seq data.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG4562-RC
          Secondary FlyBase IDs
            References (0)