Open Close
General Information
Symbol
Dmel\Awh-RC
Species
D. melanogaster
Annotation Symbol
CG1072-RC
FlyBase ID
FBtr0330070
Feature type
Associated gene
Evidence Rank
Length (nt)
2104
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 56 )
Sequence
CCGGCAGTTAACGCAGTGGCCTCGAAGCTGTAACAACATCTCGCGTCCGCTCGATCCGCTCGATCCGCTCCGCTCCGTCA
CGAGAAAAGCGAGAAGCGCTCAGAGTATCTGCAGTGAAACGTGTTATCGTGATAAGGTTCTACGAGTATTCCATGCCATA
AGGTGTCGCACATTATATTATTGAAATCGAAACGCAACATTCGCCGTCGGCTAAGAAAGTGAACTGTTATCGAATGTGCT
AATCAAAAACAAAAAAAATGTTGCAAGCGCCTGCAAATTGATTTCTATCTCGGATATGCGAATTTACACTGGTTATTAAT
AGATCTGGTTTAAGAATACGATTATATAAGCATCCTATGCAGACGGCGGCTTCCGTGGGACGCTTGACAAACTGATCAAG
TCGTCGTCTTTATCATCTATATCTCCTCATACTGGCTGCGATCGGGCTCGATATCGATTCCCAGGCTAAAGCTGGCGACA
GATTTTCGAGCAAGATACTTGGATTAACAACCGCCAAAATTGTGGAGGCAATTAAAATGAAGACTGAGCTGCGTTCCTGC
GCAGCGTGCGGGGAACCCATCTCGGATCGGTTCTTCCTGGAGGTCGGCGGCTGCTCCTGGCACGCCCACTGCCTCCGCTG
CTGCATGTGCATGTGCCCCCTGGATCGCCAGCAGTCCTGCTTCATCCGGGAGAGGCAGGTGTACTGCAAGGCCGACTACA
GCAAAAATTTCGGCGCCAAGTGCTCCAAGTGCTGTCGCGGCATCTCCGCCTCGGATTGGGTGCGTCGGGCACGGGAGCTG
GTCTTCCATCTAGCCTGCTTTGCCTGCGACCAGTGTGGACGCCAGTTGTCCACCGGCGAGCAGTTCGCCCTCATGGATGA
CCGGGTGCTCTGCAAGGCTCATTATCTGGAGACGGTCGAGGGTGGCACCACATCGAGCGACGAGGGCTGTGATGGCGATG
GTTATCACAAGAGCAAGACGAAACGGGTGCGCACCACCTTCACCGAGGAGCAGTTGCAAGTGCTGCAGGCCAACTTCCAG
ATTGACAGTAATCCGGATGGCCAGGATCTGGAGCGGATCGCCTCGGTGACCGGTCTCAGCAAGCGTGTGACGCAAGTATG
GTTCCAGAACTCGCGGGCGCGTCAGAAAAAACACATACATGCTGGTAAGAATAAAATACGCGAACCGGAAGGAAGCTCAT
TTGCGCGTCATATTAACCTGCAGTTAACGTATTCATTTCAGAATAACGCACAGAACCCAATGCATTTGAATGGCTCTAAA
GCGGGTCTATACCCGACTCATGAATCCTCTATGGATGAATTGTCGCAGGACTCCAGTGTACACTGTATGCCCAGCGAGGT
GTGACTGGAGCAATCCTCGCCAGCTCGAGCACATCGCTAGATGGCTGGACACCCACAAAACGTCCTTTCCTAGTCAAAAT
TTATGTAATGCGTCTACACGAAAGCAGTTTCGATTCGATCCGGAGAAAAATTGAAAAATAATGAATCCTTCAACATCATA
CAAAGCAGTCCCGGTTTTTAGGCTTTGAGCAACCCGAACGAACCACCCAACGTCAACACAGTGAAATCTCATCATAAAAG
ACACAGCAAACAAACAAACAAACAAACATTCCTGCATTGTAGTCTAAGAAACTGCAGCTTAGTTAATTTAATTTAAATGA
AATTTAAATTTAATTTAGTTTAATGTTCAGTAACCGATAAGTGTTTCCCACATCATTCAACTCGAAGATTGATAACTGCT
TGCCAAGGCTCCTGTAATATATTTATGCGTATGCCTAACCAATCATTGTCGTATATTTACCATGAGAAACGTTGTTATTG
TTTATTTTCTTGTTTTCTAAATGTATAAAAATTGATTTAAATATATAAATATATATATATAAACTTAGTTCTATAGTCGT
ACCCTAAATATAACTCGCCAGGCAATTTGTATATAGTAATGATAGCCGAAATTGATAAGCAACGCAGAAAACACAGCTAA
AAACTAACATTTAGTTAACAAAAATTATAAAATACAATTAAAGATGAACCGAAATCAATTAAAAAAGAAAAGCAAATTAA
AGAGAAAACAACTTTTTCAAAAAC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0073155
2039
FBtr0073156
2104
FBtr0330071
2092
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0303103
287
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0073013
214
FBpp0073014
275
FBpp0303104
271
Comments
Stop-codon suppression (UGA) postulated; reflected in aa sequence of predicted polypeptide.
Transcript terminates at site supported by polyadenylated cDNA.
translation_exception: stop_codon_readthrough
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
Awh-RC
Secondary FlyBase IDs
    References (0)