Open Close
General Information
Symbol
Dmel\2mit-RB
Species
D. melanogaster
Annotation Symbol
CG42573-RB
FlyBase ID
FBtr0330143
Feature type
Associated gene
Evidence Rank
Length (nt)
8905
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 12 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AGTCTAGTGCTAAATACATCGAGGCCAGGACACGCGACCCGAGAAAGCGTCGATTCAATCAAACAAAAACCAAGTGCCAA
        GTGCCGTGTGAAGAGGCCACAAACAACTAACTAACTAACTGCCTCCAGAAACTGTGCGATTCTAACCAAAGCCAAAAATA
        AATATAAAAAAGTTACCAGTGCATCAGTGCCCGGGAAAAAGACTTAAAGCAAACAGCAGGCGAAGTGAATAAACCATAAA
        CAAAACCCCCGAAAATAAACCGAAAGCAGGGAAAAAACGAAATTTAAACGTCTGTGCATATTAATCAGAACGAGAAACGT
        GAACAGGATCACGTCCTAGACAACTTATCACAGAGGATTTACGCAGACAGACAAACGCAGGACGCGAATGCGAGTGTAGA
        GCAAAAGGCAGCGCTAATCAACGACCAAACCAGACGACATCCTTACCGACTGGCCACGCCCACAACTCCCCCTCGAATAG
        GAGAAAAAAAAAACCACCAGAAGCCTGGGAGGAGAAGAGCAGAAGCCGCCTCATTTGGCCACTGCGGATTATGTTAATTA
        GATTTTAAGCACGCGATAACAAAAACGCCGAGGGAGCACTTGGCATTGTAATGTGACAACAGTTGGCTAAGGACAACAAA
        ACAATACCAAAAGCGGGCCATCAGGAGTAGCTGGAATGCTCGCTTTTTAATTGACATTTGCTCGAGTTGAGTTGCGTTTT
        GTTCAACAGCAATTAGCATCGTGAAAAAAAATAAATGAAAACACAAAAAAAAACGCAGAGCAAAACACAAAGCAGTGCAA
        TTAAAATTGTAAAACAATTGCAGAACGTTGAATTGAAAAGGGGGAAACAATAACAGACGACGTCGACCCGGAATAGAACG
        ATCAAGTTGATTTAATTAAAAATTCAGCATCAACCTCGCCAGCATCAACCAGCGTCCAGCAGCCAACATCCAGCATCAGC
        AGCCGTGTGCAATGGCATTTGAGCACGCTGCTTGAGCAATGGCCGCCGGACCGGAAACGCAGCCATTGCCCTCGGGCAAC
        ATCCGCCTCTGACTGCCGCCGACACTTGTCACATGTTTGGCCAAAAAGGCGCGCACGTGACGCCCCCGGAAAACCAGATG
        AACGAACGGATGAACGAGGAAATGAATGAGCTAGCAGCCATATTCAAAATTGAACGTTAAACGTTCGCACGTACCGAGCA
        TAAATTCCAAGTGAAATAAAAGAGCCAAAAAAATAAAAAAAAAAATAACCGAAACGAAACGAGGACCTCCCCATTTATAC
        CACCAATTCAAAAAAGAAAGGTTGAAAGTGGGTCGCAAAATGGTGAAAATCGTGAACCAACACTGTGATCTAGGCCTGGC
        CCTTCTCCTGGCCTGGACGTGGCTAACAAGGCTGGTGGTGGCGGCCCATCTGGTCGACATCCCCACCTCATCACGCCTGG
        CCGCTGAACGGGAGGAGCAGCAGTTGTCCCGGCAGGACGTAGGACGGCTCAGCTACCAGAGTATCCATCGTATGCTGAGG
        GACGAAAACGAACCGGATAGCTTTCGGGGGGAATTGCGATACCAACAGAAACGCCACAAAAGGGAGCTGGAGCTGAATGC
        GCCGGCCAACAAGCTTAATCTCACCCACCGCGATTTGAGGACATTCAATAGCACTGGTGGTCAGTGGAAGGGCGACTTTC
        AAGTGATCACCGCCATGGATCTGAGCAGCAATCAACTGGAGAGCCTCAGCTTGGACAACTTCAATCAACTGAGGCAGCTG
        GACTTGGGAAATAACTCCCTGGAGGTAATACCCTTGAGTTTGGCAGACACCAATATGTCACTACCCTTTGTGACGCTCGA
        TCTTTCCTGCAACAAATTCAGCCAAATTTCTACGAGCTTTTTTGCCCAGCGATTGCCTCAGTTGAAAAATCTGAATCTGG
        CTCACAATGAATTGCTAAATATTTCCCGGGAATCATTCTATAATTTATTGGAACTACAAACGTTAGTTCTCAGTCACAAC
        AACATCTCGGATATTGACTATGAAACATTTTTGGCACTACCGAATCTGCAATATCTGGATTTATCCCATAACCGCTTGAG
        TGGATCCGCTATTCGTGCTCTGCAAGGAATTCCGGATTTGGTCAGCCTTTCCATCGCTTACAATCCAGATGTGGGAGTGG
        CGATGCAGGAGTTCGTTGCTTCCTGGAGCCTAAAGGAGTTGGATGCCAGTGGCACTGGATTGTGTCAGGTGCCTGCAGCT
        CTAGCCCAATCCGTGAGGACTCTCAAGTTGTCCGACAACTGGCTCAAGGCAATTAATTGCGGTGACATGGACAGCTATCC
        GCTGCTGCAGTATCTTGATCTCTCGCACTCCCGCATTGCCCAAGTGGAGGACGATGCCTTGGGACGATTGGAGCTCCTCG
        AATCCCTTTTCCTAGACCGTAATCTACTGATGCGAGTGCCAAGTAGTCTGCCGCCATCGCTGGAACACTTATTTCTGCAG
        CACAATCAGATAATGGAGCTTCCGCCACAGGCTTTTGTGGGATTGGTCAATCTACAGACTCTGGACTTATCCAACAATCG
        ATTGATCTTCCTGCCCCCGCTATCGCTCCCCAAATTGCTCACCCTGAATCTGGAATCGTCAGGGGTGGAGAGCGTTAGCC
        AATCGATAGTGCACACACTGCCACAGTTAAGGGATCTTCTACTGGAGGACAACCCCATTAAGTGCAGCGATTTGCTGGGC
        ATTGCCGAATGGGCCAGTCCTTGCAGGTCAGTGGATGCGGGTCAATCGAATGGGGCAAGTGTAAGTGGGCGCGTGGATTT
        GAAGACGGAGTATCTGCAATTCCACAATTTTTACGAAAACTTCAGCAGCCGAGAGTGTGGTATAAGAAAACCGGAAAATG
        ACACAAAGCCGCCTTCTTGCAGCCTAACAAGGGCATCAGCTACATTAACAACAACACCCAGAAGTATGTCAAAAGTTGAA
        AAGTCACAAGAAGCACAAGCAACAGCAACATCAGTGGAAGTAGCAGCGGCAACAGCAGCAACATCAGAAAAAACAGGCAT
        ACAAGCAACATCAGCAGCACAGTCGACTGCGGCGGCAACAACAGCAGAAAGAGAAGCAATTGCAACAGCAACATCAAGCG
        ACACCACAGCAACACCAACACTCGCAGCAGCAGCAGCAATACAATCAGCTGGCAACATCCCTGCCCAGTTAACCACAAAA
        ACGTTGCGGCCCACAGAAACAACTTCGTTAGCGCAACTGCAGCGTCGGCAACAAATGCCTGGCATGCCGGCCAAAACAAC
        AGAAACGCCAGCAAAGAACCTGCCAAGTTTGGCCCAGACAAAGGCAACAACAGCGCTTCCCATTTTGGCAACACGAGATG
        CTGCCACAGCAACAACGGAAATAAATTCCGACAAGCCAACGAACATTAGCGGTGCCACAAAAACAGTAGCAACATCAGCT
        GCAGAAATAGCAACACCACCAGCAATTGAAGTGCCACAAACCATTTTGGCCGGCAAAAAATCTGACAAAATGCCAGCCGA
        TAAGGCACACGAGACTTTATTAAAATACCCAACAAGGGACACATCCGGTCAAGTTGCAACAACGCCACACAAACATGCAA
        CACTGCAGCTGCACGTTAAGGATCGACATCTAATTGGCACACCGCTGCTGATGCACAAGGGCGATGTCCTATTGGTGGAT
        GCCGAGCAGTTGTTGCTGCCTGGTACGGCCACCGTGGCGGATGCGGATTCGGAAGTTCTGGACCCGAGCCAACAACATCA
        GTCAGCGGAGCAGGAAAAGCACCAGTCAGCGACTGATAAGCGGCAAGCGGATGCAATAAACGGCGACACGAAGTCGCCGG
        CGAAAGGCCACAAAAAGAAACCATCGCTGAGCATCAAGAAGATGACCTACAGTACCAAACACGCGGCAAAAACCGTGGAG
        GATATGGCAGCCACCTCGAAGACACCGCAACACCAACATAGCAGTGTGAACACACCCAAAGAGGCTGCTCCCGAGGAGTT
        GAGCACCTTTGCGCAGCTTAAAGCCTATGTGGAGCTAAAGAGCGAATCGAAACCGGAACACCTAATGGACCAGCGGGAGG
        AAAACCATCATAATCTTACAGGAAATCATCCAGGAGTCATGCTCCTGGTGGCCTGCGTTTTGTTCATCGTCCTGCTCGCC
        GGTTTGGCCCACGTCTATCGCTGTGAATTGCCTTGGCAAAGGAGCAACCGCTCTGGTCAATTGCGACCGCATCATCAAAG
        ACACCTAAACGAAACCGATGATGCGCACAGCTTCCTGCACTATCAGGGATCTGTGAACTCCAATGGCGGTGATCCGGCTC
        GCCTGCAAAAGTGGCACCACAGCACGCGGAGAGAAGCACCCTACAGCTCCCCGCTGCACAATCTACAAGCGCGGGAACTG
        CAACAGCAACGCTGCCAGCAATTCTATAGCTCCTCGCTGGCGGACAAGAGCTCCTCCACCTCGTCTTCCTCGTCGGGAAG
        CAGTCGCAGTAGCCTGCACTCGCCCAGCAGAGATGACAGCTACTATATAGAGATGGCGCCCAGTAGTCCACCAGCAGCCA
        ACCTGCCCAGTTTGCCCATGGAACTTTTGGGCAGCCGGAGTAATGCCCTCGGATGCCGGACGGATCGAGTGGCAGCCACC
        GATCTGGGCGGTACGACAGAGGCGGTACCCTCTTCGGCGGCGGCCATCAAGTCGGTGAGCAGCAGACTGATGACGCCCAG
        TTCGCGGAGGCTGAACATCTGGTGACAAACCGTCTTTGGTCAGCGACAATACGCACCCTTTCAGTAGAGTAAAAAATTAA
        GTATGAATGGAGGTCGAACGACAATCGCCAGCTGCCAACTTAACGAGACGAGTCAGAAAGTCGGAGCAGAAAAGGGAAAA
        TATTGAAGTTCTTAAAAATATTTTAAACATTTTTATTTCCCGGATAATGTTTCTATGCCGAAGTGCTCGTGATTTGAAAT
        TTTGAATCAAATTTTGAAGAAAGGCATAAATTACACCAGTTAACAACTTTAGCAAGTCGTTAGGTAAAACTTTAAAGTGC
        TTGGCAACCCAACGTGTCCTGTCGATTTTTTGTAGGCCGATACTCGAAAAAAGATAATGGTTAGAAATAAAACTCCAAAG
        AAAACCAAAATGGGACTACGACTGCAGAGGGAAAGCATAAATGCCAGCAGCTTTATATATTATTTTCAGTTGGCTCCCGG
        CTTGATTTATGATGCCTCAGTGCCCACACATTGCAGACCTCTTAGCGATTCGGTTAGCAGCAACAATTTGTCATAAATTC
        CTGTTACGTATACGCCGCGTAGTCCCGGGCAACTAAGGCGGTCGAAAAAGGGGAGGGGCGTAGACAAGCGGCCAAGTCAA
        ATGGCCAAAGAGCCAACGCCAGCAAAGTTTTTACGAGCCAGCCAAAGAAGACGATGTCCATCTTGTGGTCTTATTTGGGT
        CAGTTTACTGGCCAGGACCACCGTGTGCGGCCCAGTTAACTTTATATAAGTGCCTGTCCGCTTGCCAAGATTAAGTGTTC
        CGATAGTCATGCATATAAAAATGAAATATCGATCAAGTATTAAATAACAATTTAGTTTATGACAGACCCAATTCAGTAAT
        CAGAAGTTGAGGCCGCGCATGCTGAGCCACCAGCCAAATTAATCGAGGAATATTGGTTGGTAGTAAATATAATATGGTAG
        TTGGAATATAATATCATCCAAATTGGAAAATTAGGTGTGACTTGCCAACAGAGCAGAGAGAAAAATAAGACAAGGCCGTA
        CAAAGTGAATGAAGTACCTTGCTAAACATTGTGTTACAGATTTTAAGTTGGTTTTAGATCTAACACTTAATTTGATGTGG
        TGCGCCACTTTCGAATTTTCAGCATTCAAGCCAAGTCCTCCCTGCTCTTATTATCCTTTGAGCCATTCTGCGCGTCGATG
        TTCAATGCTTAGCCAGATCTTAACCTACTTTCACAGCTGCTTTAGATACTAGAGTTTAAATTGCAGTCTAATTAAAGTTT
        CGCCTCAGTCCCTTTCGCCACCTACCCTTTGGATACTAGAAGTGTTTGCTATCTGCACTGGCATCAAGCATTCTTCACCA
        CATTTGAAGATACTGGGCAAAACAGGCACAAAACACCCTCTTCCTTGAGAATCAACCCGCACTTAACCTCATTTTACAAA
        TTGACCAACACAACATATGGTGTAAATCCAGCCAAATGGCCAGACATCTAATCTGCCACGCCAAAAGTGAAATGTTGTAA
        AACTATTTGGGGGCTATACGTACATGTATCTAGCGGACATCAAAATAATGTGGCTGCAAATCAAATTACAAGACACGCGG
        CTGGCTCTTCGGGGGTGGAAAAATGGTTAGGGGAACGACCAAGGAAACGTCCCACAGACATAGAACACAACAATTACATT
        AAGACACGATAAAAAGTTGTGCAACAATCTTGCAACCCCAACCACCAAACTAACCCAACTACGCCGAACTGAGCTGAAGA
        TGGTACCATCTCCTCCGAAGGGCAAACCACAGTCATTGCACAGCTTTTTCAACTTTTTGCGGCTTTGTAATTGGAATACA
        AGAAGGAGGCGCGTGCACACAAGCGGCAGCAACAGGAAACAGTCGGAGAAAGTGAAATGCACAGTTAGATTCCACTTAGA
        AAGCACTCGGAGAAATAATCAAAACCTATGGTCACACAAATACTGGGCAAGAATGGCATTCTAGCTGACTACATACAATC
        TTACTCAGCGATATTGTAAAAATGAAATAGGGTTGTTCGACTGAAAAGAAACTTATATGAGAAACAATACTAAAAACGAA
        ATTTTACACTTTCAAAGGGTCATAAATATCATTTTAAAATATTCAAATACCAAAGAAGTTTCCTTTTAGCAAACTTACAT
        GCAATATATTCATATTTAGATGAGAATGGAACAATTCTATAACTCTATACTTCTATACCCAATTTTCCCCAAGTGCAGAT
        AGATACCACTTCTTTGGGAAGGGAGCGGGATTTCAGGAAGGCGTTCAAGCAGAGTCCGCTTAAGCAATTCAGAAGGATTT
        ATTTTCGGCCACAAAAGCGAAATGCCCGACAAAGCGCTCCGAACAACAATTAAAGTAATGCTGACCAACAACCCCCTGCG
        CCCGATTGGGTGGGATTAGATGGCGGGGAGTCCTTTTCGGTCCTGTCCAGTCCAGTTGAGTGGAGTGGAGTGGCGTCCGA
        TGCCAGGACGCACAAAATCTTAATTAAGGAACTTCCAAGTGGGCAAGTGTCGAACGGCAACGGAGGAATGGGGGCATTTT
        TTGAGAGTTTCGCAGGGCGAAAAACCTTTTTATTTGTCGGCTTGCCAGCACAGCACAAAATTCGCCTACAAAAGAAACCC
        TACGGCAGAATGACCCAGAGAGTCCGGTTGGATTTAGTCCTCGAGCATTGTCAAATTTAATGAAGGTTTCCCTTCTTGGA
        CTTTGTGCTTATGACACTGGCCAGCTGGCCAAGATTTAGGAAGTTTCCAGTCGAGGGGCAAGCAAGTGAAATGAGTTAAT
        TCGATATTTGACACTTTCGGAGCTCGCATTCCACACAATCTCGGTATGTGTGATGGGTTCCAGGGTTCCAGGCATCCAGA
        GACCCCCGGACTTTTGTCTCCTGTGCAGTTAATAAAGTTGGTCCGGACCAGGACGTAATTATTTGCCTGCTAAATGGCTT
        TTGGACGACATTTCGGGGCCGTAAATGGGGGCGATTTAGAAAATTATGTGAAAATAAGTTGCCTTTTGTTTGGCCATTGG
        CCGTTGGCAGTTAACAGTTGGCGGTTGGCGGTTGTTCGGGATCGTAAATAACGTTCATAATTGGGTAGACTCGAAAAGTT
        GTGGGGCAAAGGCAAACAGAACTCGAAATAAACATCTCGGCCGTATGGATAGCAAACAATAATTAAACTTAATTGCGCTG
        TACATTGAAACGTCAAACTGTAAATTATAGTTATTAACATTTACTTGTAGTGGAGTTTACTTGAACTAACATTTCAATTC
        CGAATATTGCATGTACAATTTCCATAGAATATGTATTTAAAACTTATCGCAACAAAGTGGATTAAAAGTAAAACGGAACA
        AAGCGACAGCCAGGAAAATACAATTCGAGTAACGTTAATATTTGCATTTAATTTGTCGAAAATCAAAGTAAAATGCGATA
        AAAACCCACAATAAAAACAAAAACTAATTGCCAAATATTTGACGTACAGTTTGTAGCGTTAGCCATTAAAACCTTTATAT
        GTACGGTTACATATAGACATACATACATATAGAAACAAAGAAATGCGAAAAAAGTGACATACATCTAGCGCAAATCCGAG
        CAAATAATTATTAAACAAATACTTCTATTTACAAAAACACATCAAATATTTAGTTAAGCCAAAATGACGCGCAGCATTTT
        AATTAAACAACAGAAAATCGAGCTCTCAGAGAAACAGATGCAAAATGCAAAACATCCAATAAGTAAAGGTAAACAATAGT
        TGCAGCATAATTTCCGTGTGTATTTGTAAATAGACAACTAAAACCAAATATGAATATATTGAAAACAAATATTGGAACAA
        ACCAGCAAATGAACAAAGAGTATTCGACAAAGAAAATATTTGCTGGAGGACAGTTCCAAATATACATATATACATATAAA
        TATAAAATTAATGTTAGATTTAATGTTGCCAAAATCGGAGCAACAAGTGTTGATGACAAAAACTAAGAACATGTATGAAG
        ATTAAAAATAACAATAGCACTAAGTGAAATGTATTATTGATATAGCAAATATGGATAGCAATTAAAATTGTAAAGATAAC
        ATGGCAAACATTTTATGAAATCTTCTTGAAAACCAAAACAATTTTAATGCAAACAAGAAACCGAAAAAAATGTGAAAATA
        AATTGAGAAATTTAATTTGAAAGAG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0301436
        8905
        FBtr0344729
        3860
        FBtr0344730
        5399
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0303176
        1155
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0290651
        1141
        FBpp0311062
        1141
        FBpp0311063
        1141
        Comments

        Stop-codon suppression (UGA) postulated; reflected in aa sequence of predicted polypeptide.

        Transcriptional initiation is supported by short-capped RNA data (FBrf0209722).

        Extended 3' UTR based on RNA-Seq and/or EST data.

        translation_exception: stop_codon_readthrough

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        2mit-RB
        Secondary FlyBase IDs
          References (0)