Open Close
General Information
Symbol
Dmel\Tl-RD
Species
D. melanogaster
Annotation Symbol
CG5490-RD
FlyBase ID
FBtr0330155
Feature type
Associated gene
Evidence Rank
Length (nt)
4710
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 84 )
Sequence
AGTTCAGTTTGTTCCGAATCGCCGACGTGAACGCACGCTTGTCGCGCTTGTAGCAGTTGGATTTTTGATTTTCCCAGCCA
GAGTCCCGCGTTCGTGTGTTGTGGGCCGCTTTTGTTTGTCTCGTTTTGTGGCCAGCGATTTGGCAACCGAATAAGCCAAG
TTAAGAGCAACGCTACGCAGCACAAAATCCATAAAAACAAGAAACACAAGGCGCAATTAAATGCAAATGTGTGAAAGTGT
AGCAAGCATTTAACCAAAAATAAAATCGCAAAAAATCGCGGCTTCAAAGTGCGAACAAGCGCGAACAGAGAAGCTAAACA
ACAGTGCCAGTGCGTGTTTGTTCGTGGCAGCTTAAGAAAAGCCAAATAAATATTAATATTTGCACAAGAGATCGCAGCGG
AGTAGCTAACCTCACATTTAATAAAACACGTATTAAAACGGTAAGCAGAAGCATTGAGCAGCTTTAAGCATCCGAAATTC
AGAGCATATTCTGTGTGAACCTCCTTTGATAAATTACTTAAAAATACATAAAAAATGTTCAACCGACTGCAGATGCATCT
GTAGTGGACGCCAGGATACAAGGATAACACATCTGCCTTTCTCCAACCAACAAGTACAGTTCTGAGCAAGTGAACCCATT
TGGACAACATGAGTCGACTAAAGGCCGCTTCCGAGCTGGCATTGCTTGTGATCATCCTGCAACTGCTACAGTGGCCAGGA
TCTGAAGCATCCTTCGGTCGGGATGCGTGCAGTGAGATGAGCATAGACGGACTGTGTCAGTGTGCACCCATAATGTCGGA
ATACGAAATCATCTGCCCGGCGAATGCGGAGAATCCCACGTTTAGGCTAACCATCCAGCCCAAAGACTACGTGCAGATCA
TGTGCAATCTGACGGATACCACGGACTACCAGCAGCTGCCGAAAAAGTTGCGGATCGGTGAGGTCGACAGGGTTCAGATG
CGACGGTGTATGCTGCCCGGTCACACGCCGATAGCCAGCATCCTGGACTATTTGGGCATAGTGTCGCCCACGACGCTGAT
CTTTGAGAGCGACAACTTGGGCATGAACATAACACGGCAGCACTTGGACCGTTTGCACGGTCTAAAGCGATTCCGGTTTA
CCACTCGCCGTCTCACACACATTCCCGCCAACCTACTGACGGATATGCGGAATCTGAGTCATCTCGAACTAAGGGCAAAT
ATCGAGGAAATGCCATCGCATTTGTTCGACGATCTGGAGAACCTGGAGTCAATTGAATTCGGTAGCAATAAGCTGAGGCA
AATGCCGCGTGGCATTTTCGGCAAGATGCCCAAGCTGAAGCAGCTCAATTTGTGGAGCAATCAACTGCACAACCTCACCA
AACACGACTTCGAAGGTGCCACCTCGGTGCTGGGCATAGATATTCACGATAATGGCATCGAACAGTTGCCGCACGACGTC
TTTGCCCATCTCACGAATGTCACGGATATCAATCTGAGCGCCAATCTCTTCCGTTCCCTGCCGCAGGGCCTATTCGACCA
CAACAAACACCTGAACGAGGTGCGTCTGATGAACAATCGAGTGCCCCTGGCCACGCTGCCTTCGCGTCTGTTTGCTAATC
AGCCGGAACTGCAGATCTTACGGCTGAGAGCTGAACTGCAATCGTTGCCGGGTGACTTATTCGAGCATTCCACACAGATC
ACAAACATCTCGTTGGGAGACAATCTGCTGAAAACTCTGCCCGCCACCTTGCTGGAACATCAGGTGAACCTGCTGAGCTT
GGACTTGAGCAACAACCGGCTGACACATCTGCCGGATTCACTCTTTGCACATACCACCAATCTGACGGATCTGCGTCTGG
AGGATAATTTGCTAACCGGCATTAGCGGCGATATATTCAGCAACTTGGGCAACCTTGTGACCCTCGTCATGAGCAGGAAT
CGACTGCGTACCATCGATTCCAGAGCCTTTGTAAGCACAAATGGACTGCGACATTTGCATTTGGATCACAACGACATTGA
TCTGCAACAGCCATTGCTGGACATCATGCTCCAGACCCAGATCAACTCCCCGTTTGGTTACATGCACGGCCTTTTGACCC
TTAATCTACGCAACAACTCAATCATATTCGTCTACAACGACTGGAAGAACACGATGCTCCAGTTGAGGGAGCTGGACTTG
AGTTACAACAACATTAGCTCGCTGGGCTACGAGGATCTGGCGTTCCTGTCTCAGAATAGATTGCACGTAAACATGACGCA
CAATAAGATACGGAGGATAGCGCTGCCCGAGGATGTGCACTTGGGCGAGGGCTACAACAATAATCTGGTGCATGTGGATC
TCAACGATAATCCCCTGGTCTGCGACTGTACGATCCTCTGGTTTATTCAGCTGGTGAGGGGCGTCCATAAGCCGCAGTAT
TCCAGGCAGTTCAAATTACGCACAGACCGATTGGTTTGCAGCCAGCCAAATGTCTTGGAGGGTACTCCAGTTCGTCAGAT
AGAACCACAGACGCTCATCTGTCCGCTGGACTTCTCCGATGATCCACGGGAAAGGAAGTGTCCGCGCGGCTGCAACTGCC
ATGTGCGAACCTACGACAAAGCACTGGTAATCAACTGCCATAGTGGCAATCTGACACATGTTCCTCGCTTGCCCAATCTG
CATAAGAATATGCAATTAATGGAACTTCACTTGGAGAACAACACACTGCTCAGGCTTCCTTCGGCCAATACACCCGGATA
TGAGAGTGTAACTAGTCTGCATCTGGCTGGCAACAATCTAACCAGCATCGATGTGGATCAACTGCCTACCAATCTCACCC
ATTTGGATATAAGTTGGAACCACCTGCAGATGCTGAACGCAACCGTGCTGGGTTTCCTTAATCGTACCATGAAGTGGCGC
TCGGTGAAGCTGTCCGGGAATCCGTGGATGTGTGATTGTACTGCCAAGCCGCTACTCCTCTTCACCCAGGACAATTTCGA
AAGGATTGGAGATCGCAATGAAATGATGTGCGTGAACGCCGAGATGCCAACACGAATGGTGGAACTGTCGACCAACGACA
TTTGTCCGGCGGAAAAGGGCGTGTTCATAGCCCTTGCTGTGGTGATTGCCTTGACTGGTCTTTTGGCCGGTTTCACAGCG
GCACTGTACTACAAATTCCAGACGGAGATCAAGATTTGGCTGTATGCTCATAATCTCCTCCTGTGGTTTGTCACGGAGGA
GGATCTGGACAAGGACAAGAAGTTCGATGCCTTCATCTCGTACTCGCACAAGGACCAGAGCTTCATTGAGGACTACTTGG
TGCCGCAACTGGAGCACGGTCCTCAGAAGTTCCAGCTCTGTGTGCACGAACGAGACTGGCTGGTAGGCGGACACATTCCA
GAGAACATTATGCGCTCTGTGGCGGATTCGAGACGAACGATTATTGTGCTCAGCCAGAACTTTATCAAATCGGAGTGGGC
ACGCCTTGAATTCAGGGCGGCGCACAGATCGGCACTGAACGAAGGACGCTCGCGCATTATTGTGATCATATACTCGGACA
TCGGAGATGTGGAGAAGCTGGACGAAGAGCTGAAGGCCTACTTGAAGATGAACACCTACCTGAAGTGGGGCGACCCGTGG
TTCTGGGATAAGCTGCGATTTGCCCTGCCACATCGCAGACCCGTCGGCAATATCGGTAATGGAGCGCTAATCAAGACGGC
GCTGAAAGGTTCCACGGACGACAAGTTGGAGTTGATCAAACCGTCGCCGGTGACGCCACCGCTAACCACGCCGCCGGCGG
AGGCAACCAAAAATCCGCTGGTAGCGCAGCTAAATGGCGTCACCCCGCATCAGGCCATAATGATTGCCAACGGCAAGAAT
GGTCTGACGAATCTGTACACACCCAATGGCAAGTCGCACGGTAATGGCCACATCAACGGCGCCTTCATCATTAACACGAA
TGCCAAACAGAGCGACGTATAGGACTGGGAGAAGGCGGAGCTGTTTCAGTTCGATCCCGACGATGAGCTATTGTTCCGTT
AAAGAGAAGCCTCCAAGAAGAACACTGCCACTGACGAGGCGGCGGTGAAAAGACCCAGCTGAATGTAAAAAGTCTAGAGA
ATATTATCGATTTCCTCGTGTTTGGTCAAGTTACAGTCGCCCTCTTATAGGTTTAAATCTCTTGCGCTGGTAGTGAAGCT
ACAGCAAAACTAAGTGAAAATTTCAAATTTCATTATTTCATGTGGCCTTTGTTGACGAAAAATGAAACAAAAATGTTTAG
TTTGAGGAAAGATGGAAACACAAGCTAGTTTTAAACACATCACTCTGTTTTAAGTGTTATCTGTAAGCTTAGCATAGACC
CTGTGCAGACTCTTGTAGACATAAAAATCTCATTTATTTAGTAATTATTTGTACATTAGGATTATTGCAAGCTGCCGCAT
ACAAAACTGAGAATAGCTCAATGCTAAAATACCTTTTGAAATGACCACTTTTATTTATGTTTTACCTTTTAACAGAATCT
CAATGAAATGGGAATCTGAATTTTGAACAAATCGAGCTTTATTTCGAACTAACTACTTATTATTTGTTAGAACGCAGCCT
ACAACTAGGTGAACCACTTGCAATACACATACGACGTATCCAAATAGTAGTATAGACTCTGTAATTGTGTGAACAAACGC
AACAAAAGCAGCCGAAATGAAATACAAATTGCCTTCTTTGTATGTATGTATGTACGTATGCTAGATATAT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0085059
5129
FBtr0330154
5129
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0303188
1097
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0084431
1097
FBpp0303187
1117
Comments
Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
Tl-RD
Secondary FlyBase IDs
    References (0)