Open Close
General Information
Symbol
Dmel\Zif-RC
Species
D. melanogaster
Annotation Symbol
CG10267-RC
FlyBase ID
FBtr0330191
Feature type
Associated gene
Evidence Rank
Length (nt)
1455
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 17 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          AACCAAAAATCCGCTTCCCGGAACCAGCAAAATGAACCACATCGTGTTCGCCGATGCTATGCAGCCCTGCAACACAAATT
          TTAACACTACAATACTACGCGAGCGGTTCTTTAAATTAAATTTCGAGCAGGATTCCAGAATGCGCGTCGAGCTTACCCCA
          CAGACGTGCCGGGTCTGCCTGGCGCAGAGTGAGCGACTGCAGCGCCTAGACGAGATCCGCGAGGAAGGCGAGGAATCGCC
          GAACGAGATGTTGATTCAACTTTTGGGAGTCTCATACAGCAATCTGAACGACAGAGAACACATACCCGATGGCATCTGCA
          AGTCCTGCAAGGTCGAACTCAACATGGCCTACCAGTTTCGCGAGAAGGCGCTGCGCAAGCAGATGGAGATTGAGGAGTAC
          TGCCGGGAACTGGGCTTGCTGGACGAATCAGATGTGATGATGATCAAGGAGGAGGACGGCTCGCAGCAGCAATGCGACGA
          GGAGATGTACATCCTGGAGGAGACCACCACCGGGGAAGAGGAGCACCAGGAAGAAAAGGGGCACGAGGAGTACTTGGAAG
          TGGACACCAGCGATCAGCAGGAGTGCATTGGCGACACCATCGAGTACTTGGAGGACAACTACACCATCGAGATGAACTCC
          GATCAGACCGAGATCGTCCTGGAGTCTGAGAAGCAGTACGAAGAGACACCATCGCAGCAGTTGGCGCTGCAGGAGGCGGC
          CAAGGCAAGCCTGAAGGCGCGGCGCGGCCGGGTTCGTCGCGGATTAAACTCCCTAACAACATCGGACGGCACTGAGAAGG
          GTGGCTATATCTGCGACGTCTGCGGAAACTTTTACGAAAAGCGCGGCCGGATGATGGAGCATCGCAGACGCCATGACGGC
          ATCTGCCAATATGCATGCGAACTATGCGATGCCAAGTTCCAGGTGCGCGAGCAACTGAGGAAGCACATGTACTCCCACAC
          GGGCAGCAAACCCTATAAGTGCAGCTTCTGCAGTCGTCAATTCTTCTACGAAAGTGTTCTCAAGTCTCATGAAAATGTTC
          ACCGTGGCATCAAGCCCTACGTGTGCAAGGTGTGCGACAAAGCGTTTGCCTACGCTCACTCCCTGACCAAGCACGAGCTC
          ATCCACTCGGACATCAAACTGTACCGCTGCGATTATTGCAACAAGGACTTCCGTCTGCTGCATCACATGCGCCAGCACGA
          GGAGACCAAACTGCACCAGAACGCCGTAATGCTGGCCGAGAGCATGAAGGTGGAAATGGTGGCCGAGCAGGGGGGCGGGA
          ACGAGATCCGAATTCAAGCTCACTGACGCAATCAAATTCAGTAGAGTATACTGTCTTATTTCCAGATATAATCCCTTATA
          ATCAGTAATACTAGCTTAAACGCTAACGGATAGCGTATTCATAGTTGTAAGAATGAACTTCATACGTAAATAAAGGTTAT
          TTTTGTTAAAAATAG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0081728
          1463
          FBtr0302383
          1394
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0303224
          388
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0081225
          388
          FBpp0291578
          388
          Comments
          Transcript terminates at site supported by polyadenylated cDNA.
          5' UTR based on RNA-Seq data.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          Zif-RC
          Secondary FlyBase IDs
            References (0)