Open Close
General Information
Symbol
Dmel\MTA1-like-RD
Species
D. melanogaster
Annotation Symbol
CG2244-RD
FlyBase ID
FBtr0330315
Feature type
Associated gene
Evidence Rank
Length (nt)
4167
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 107 )
Sequence
CATTGTGTGTGTGTGCGTGTATTTTTTAGAGTTGAGTTGTTTCTAAGATGGCGACGAAAAAAACGCGTCTTCTTATGTGA
AAAATGCAATCATAACAACTCGAGTTTTCTGCTAATAAATGTGCGCTAGTTTGGAACAGGACCATTGAAAAACAGTGCTA
AGCGTGTGCCGAGTGTTTTGCATGTGAAAGTTTTGGTGCGGTAGCGTAGTGAAAATGGCCACAAATATGTATCGAGTCGG
AGACTATGTTTACGTTGAGACAACGCCGAACAGTCCCTACTTAATACGACGCATCGAGGAGCTGAACAAAAACCAAACCG
GCAATGTGGAAGCGAAGGTCATGTGCTTCTACCGCCGCCGGGATCTGCCCAATCCGCTCGTGCAATTGGCCGACAAACAC
CAACTGGCCACCGCCGAGGACTCACCGTTGGCGACCAAGCTGAAGAAGACCTGGCTCCGCACACCCGTAAGCGAGGAGCA
GGCGGCGCAGGCTGTGCTCGATCCCTCAATAGCTGCCCTGGATGAGGAGCGCACCAGTCCAACGCAAACGTCTGGCGGAG
GAGGCTCAGCCACCGGGAACTCCGGCAGCAACAGCAGCGGCACTTCCAACAACAACAGCAGCAGCACTGCCATCGGAGGT
GGAGCGGGAGGCTCCGGAGGTGCAGGAGGCGACGCGGAGAAGGGCGAAGCGTTGACCAGCAAGCAGCGCTATCAGATCAA
GCACCGCGAGCTATTTCTGTCACGCCAAGTCGAGTCGATACCCGCCACACAGATCCGAGGCAAGTGCTCGGTGACCCTGC
TCAACGAGACGGAGTCCCTGCAGAGCTATCTTAATAAAGACGACACATTCTTCTACTGTCTGGTGTTCGATCCAAATCAA
AAGACGCTGCTTGCCGACAAGGGCGAGATCCGGGTCGGCAGTCGCTACCAGTGTGATATACCCGCCAAGCTCAAGGACAC
CGCCACCGACGACCGCAAGCTGGAGGAACTCGAATCGCTGGTGTGGACGCCGGAGCACAGCCTGACCGACCGCAAGATAG
ACCAGTTCTTGGTCGTGTCACGCTCCATCGGCACCTTCGCCCGCGCCCTGGACTGCAGCAGTTCGGTGAAGCAGCCCTCG
TTGCACATGTCCGCCGCGGCGGCCAGCAGGGACATCACACTGTTTCACGCAATGAACATTCTGCACAAGCACGAGTACTC
TATTGAAGAGTCCATGTCGTCGCTAGTTCCTTCCACTGGGCCTGTGCTATGTCGCGATGAAATCGAGGACTGGAGCGCAT
CGGAGGCGAATCTTTTTGAAGAGGCGCTAGAAAAATATGGCAAAGACTTTAATGACATTCGACAAGATTTCCTGCCTTGG
AAAACGCTGAAACAAATCATCGAGTACTACTACATGTGGAAGACCACCGATCGCTACGTGCAGCAGAAGCGAGTGAAGGC
CGTCGAGGCGGAGCTGAAGCTCAAGCAGGTCTACATACCACAGTATAACAACAATGGCAAGGGGAACGGAACGTCTACGA
AGGCGGGAGGTGGCATCTATAATGGAACCACAAACGGGAGCACAGATCTCTCCAGCAATGGCAAGCCATGCGAATCGTGC
GGTACAACGAAATCATCACAGTGGAACTCGGTCAGCAGTGGGCACAGTACGAGCCGCCTTTGCCTGAGCTGCTGGGAGTA
CTGGCGGAGGTACGGCAGTATGAAGTCGGCGACCAAGGGCGATGCTGGCGAAGGCGACGCCAAGAAGAAGTCATCATCGG
CAGCGTCGACGCCGACAGCCACGTTAGCGGGTCTAGCTACAACGCCCACGGCTGTGGTCGACCTGAATGATGACGAGAAA
ATCAGTGATCTTACCAATCGTCAGTTGCACAGATGTTCTATTGTCAATTGCGGCAAGGAGTTCAAGCTTAAGACTCACCT
GGCCCGCCACTATGCGCAAGCGCACGGCATCGCCATCAGCTCCGGATCGCCGCGGCCCATAATGAAGACGCGCACTGCCT
TTTACTTGCACACCAATCCCATGACACGGGTGGCGCGTGCTATCTGCCGCAGCATCGTGAAGCCGAAGAAGGCGGCGCGA
CAGAGCGCGTACGCGATCAATGCCATGCTGGTGAAACAAGAATTTACAAATCGTATTAGTGGAAAATCGCAGGCGGAGAT
CAAGAAGTTGCTTTTGCTGAAGCCCAAGGATCGGGGTAGTGTCACCAAGATTGCCAACCGCCTAGGTGCGCCGGGCAGCG
GACCGCATGAATGGCTAGTACTGACGCCCAAGGACAAAATGCCGCTGCCGGCTGTCGTCTCGTTCCCCAAACCCCCGAAA
GCGCCCGATGGCAGCTTGGTGTATGACCGAGTGCCTAACAAGTCACCCGACGTCGTGGCCGTGCCGGCCGACAAGGAGCT
CACAATAATTCCCACGCAAGCCACGTCGACGATACGGAAGCGGGCACACGAGGACCAGCAATTGAATGGCACTGAAGTTA
CTATAGTTCCCAGCGGACCTCCTGCCAAGCGGCCGAATAAGGATCCCATGCCCTCGCATTGTCCCAGTCCTGAGCAGTTT
GCGGCCATGATGGCGGCATCTGGACAGCCGCTCTCCAGGCATCATCTCAATGGTAAACAGAAGATTGCGCAGATGGCTCG
CGGTGGCAACGGACGCAAGCAGGTTATCAGTTGGATGGATGCACCGGATGATGTTTACTTTAGGGCTAACGATACACACA
AAAAAACGCGAAAAATACTCTCCGCCGTAGATCTGCGTCGCGCCGCGCGCAAACCATGGCGCACACTGCCCATCAAACCT
GCGGCGCCCGAGCCGAGTAGCAGGCCCATTGAATCACAAATCGTAATACTGGACTGACCGTCGCCGGCGAGCACATTAAC
AGCATCAGCAGCATCGGCAACCAAGTTGTTATCGTCTTCAGCAAGTAGGTTCGAGCAGCAACATCCTCCATTTCCATACA
CCATGGATGCACTGCTCAACTAGGAGCACTCTCTGGTTTGACTGACGGGCTTGCCATGTACATACACCCGCAGCATAAGG
CACACAGACGTGTGGACAGGCATTCGACTTAGGATCAGGATCAGTGTAGTTACAGCATCACTGTATGAACAGGACAACAA
AACGCGATACCCGATAGCAACCACAAACCACTTTATTAGCGCTTAAATAGATGTCTTTTTAACAAGAAATAGTAAGATAG
TAAGTGTTAAGGTCTGTAGCAGCAGTAACAGAACGCGAGACAACAAAATATTTATAAATATTTTATATATATTTTAAATT
TAAAAAATCTCAACACACCGAATGCAAGCTGCACTTTCCTACGAAGGTGCCAGCTGCAACGCACGAAACTCAAATGTTCG
TTAATTCGTTTAGTACACAACGCATTTGCAATGGTTTTTTAAATATACATTTGTGAATGTGTGAGTTCTGTCGAACTTTT
AAATCGCGCTCTAAAGTTCCACTTTATTCCTTTATTTCCTAAACCTAGCTAAAACCAGATACGTAATTATGAAATTGAAT
GGCCTCCGTAAGTTTTAAATGTTTTTCTGTCCAGATTTGAATTGTAAGCCGAAAGATATTTGAAATTGTTTAAGCGATTT
GAATTAGGGAGTGGAGAAATTTAACATTGTTAATGAATGTGGCGTGCAAAATTAAGTAATTAAAGCCCAATAATTTGAAC
TGTAACTAAAATCAAGAAGCGTCAACTACAAACAAACTGTACAGTAAATAACTAAAATTTAAAAGTTAAATTTCGAATAA
AGCGTATTTTCATAATGTATGTAACAAACGACGAAAGTTCGGTCATTCAAAGAGCTATCCCACACACGCCTGCACACATC
CCTCACCACCACCACAACCCCCACCCAAGCACAAGCCCAAACCCACATATAGCATATTATTATTTACGCATATAATTAGT
ACGAGTCTAAGCCGCATATAATAAGTATGTACATCCGTTGTGTATGATTACACGGAGATAACAAAGAATGTCGTCTAGAC
TCTAGAGATAGAAGAGCAGCAGCAGGGCAAGCTGAATGCAGCAGAAGCACGCAGAGCATAAAGAGAAAACCAATAATATT
AAATGATTATGAAACGTTTCGATTGTAAGCCAACATACTTTAACTTAACGACCTAAGCAATTTTGTAAAATAAAAACACT
TCAAATT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0078733
4167
FBtr0078734
4059
FBtr0290206
4976
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0303347
922
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0078382
880
FBpp0078383
844
FBpp0288645
853
Comments

Stop-codon suppression (UGA) postulated; reflected in aa sequence of predicted polypeptide.

Transcript terminates at site supported by polyadenylated cDNA.

translation_exception: stop_codon_readthrough

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
MTA1-like-RD
Secondary FlyBase IDs
    References (0)