Open Close
General Information
Symbol
Dmel\CG43394-RC
Species
D. melanogaster
Annotation Symbol
CG43394-RC
FlyBase ID
FBtr0330321
Feature type
Associated gene
Evidence Rank
Length (nt)
3186
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 9 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TCGACAGTCGTGCTGTGTTCCACAGATGCCTCAGTGAATCGAGTGAATATTGTGAAAGTGAAATAACACCGAAAGGATTA
        AGGATATTAGTGTATTCGATAAGGCTGTGGCATCAACCACTGTGTTAGCTAATTATTAACACAAAGCTGACACCGCCTTG
        CACCAGTTCTTCTCGTTCTTCTCGAGGGGCTCGTTTGGCTGCCACTGCGAAAACAAACTTTTATGCTGACAACTGAGGAT
        AGCTAAGATCATATATCAATCGAAATGATTTTGAGAACGCACCTCTGGCTGGGAGTGCTCCTGGCGGCGTTGCTACTAAA
        TACCGTAGTTTCTGGAGAGGATGAAGACTATGGCGGCGAAATGATTGGCTCTAGCCTCGGAGGCAACGATGAGATCTACG
        ATCCTGCTCAACTGGAGGCCGAGGTAGAAAAAGAGATGGAGCAGCATCGCAATAGCTTGGAGGAGGACCAAACCGAAAGT
        TCTCAAGTCATGGAGCTGGAAGTGAGCACCATGAGGCCCATGGAGAGCAGAATGAACACCATGGCTCCGTATTCCGGGGA
        AAACTCATCCGCCGAAATGATAGACGATGCTTCCACCCAAAAACGTGTATCAAAGGTGGACAAACCCGCGCGAGATTATT
        ATTACGAAGATGCGCCCGAGGATGAGATGGTTGCCAGCACAACAGCAAAAGTGGCTACCACCATGATACCGGAATATGTG
        CGTCAGGCCAAGGCAGAAAGATTCCCCCAGCGAGATCAGGAGCATACTTCAACTGACTACATCGAGGAGGATGCCACCAA
        GTCGGTGGATGAGGAGCCTCCAGCTGATCAGTTCTACCGAGTTGAGCAACACGAACCCATTCCCCAGGCTCAAGTCCAAC
        AGCTGCCCAGTCGGGACAAACCCAAACCGTTTGAGTACTCCTCTGAGGATGATTACTACGATGAGCATGCAGAAGCTAAG
        ACGACCACAACAAGCACTTCCACCACACAGGCACCTTTGCCCATACTAAGGGCTCGTTTCGGTGGATTTCCCTGGGCCAC
        CACCCAGGCACCCAGTCCTCCTACCACCAGTTCAACAAGCTCAACGACAACTACATCGACGACGACGACAACGACCACCA
        CATCAACCACAACAACTCCCAGTCCTAGAAAACAGCCCAAGCACATCCAAGTGACCGGTGGCTTAAAGCCGGAATTGTTG
        CCCGCGGATCAGCTGCGCAACTACATCAAGGATGTGTACATTCGCATGCCTCTGGCTGTGATTGTGGATCCTTCTTCCGC
        ATCCTTGGAGCAGGCAAAGCGTCTCTATATCGATGCTTTGCAGGACAAGAACATCGATATCAAAATAGTTTTGGTAACAC
        TTAATGCAGCCGGTGCTCCTTCTGCCTTCAGCTTCAACAACACCCGGGAGTTCATCGCTGGCTTGAATAGCACCAAGGAG
        CACGAGGGCGGCAACTCGTTTGTGGGCGTTTTGCATGCCGCCGAGCTGGTTCCCTACGACAGTGCTGTTTTCATCTCGAC
        CGCAGTCATCCCACCACACACGGAACTGGTCCAAGATGCGGCCATTACTCTTCTAAAGAAGAGGATCAGGTTATTCCTTT
        TGTGGTACGGAGAGCGATCGGGCAGCGAAAACGAAACGGAGGACGCAGTGGGCGGCATTCTGGGTGAGGTGGCCATCCGA
        TCCGGTGGCGAGATCATCCACATTGTGAGCACCGAGCACGGACAGCATATAGCTGGCAATACGCTCACCCTAGTAGCGGA
        CGCGTATCAAGGTAGTCAAGAGCTGGATCTGCCAGTTGACACGACGTTGTCCAGTCTTCATGTGCGAATCGATGCGAATA
        TGAGACGGGCCACGATGGAGACGCCGAATGGTGAGATCAATTTGAAGAAACTAGCGAAATTCGGCGGAGTTAATGTCACG
        GAAACGTTAAATAACCAAGAACTTGATGCCTACGTACCGCTAAACAAGCTGCGACGCGCGTCGATTTTCAAACTGAAGTT
        ACAGCCCGAGCTGCACGACAAGTACAATGTGTTTGTTCGCGCCGAAAGAAAAGCGGATGTGTTTCTGGGCGACATCATCA
        AACGCATCGACAGCTACTACAAAACCGGACAAACAAAGGCCAAATCAGCCAAACTTCAGTTTCCCGACAAGGAAAAGGAC
        ACGGAAAAGCTAGAGGAAGATGTGGACTCCCCGAAGAACGAAATCGAAACCTTTTCGGAGCAGGAAATCCAAAGTTCTCC
        TAATCTGAATCAAACGCTTTTAGCTCCCAGCACTGGGCAGTCGAGAAGCACCCTAAATGCCATGCTTCTCCAGCGATGTG
        GCACAAAAATTGAGTTGGGCATTGAATCGAAACTGCTGGTGATGGCTGGTCAAACAGCTACGCTACTCTTTGAGGTCACC
        AACATGAAAACGGAAACGGTTTACTCCACCATTCAAGTCACCGACGAGCGGCGCTTCTTGGTTCAACTGAATCCTACCAG
        ATTAAGCCTGCGCGCCCAGGAGACGGCTACAGTGCGTCTGACTGTTCTGGTGCCCACTGGCACAGCTCAGGGCACCACAG
        ACCGGATTACCTTCACCAATTACGGTCGCGAAACATCTACTCTGGCGGTAAATCTTAAAGTGGTGACTAGCATAGATGCT
        CAGGACTCAACTGGACCTACACTATCCTGGGAGTTTGGCAGCCGCTGTGATTACCTGACGCCCGAATCCCAGAATTGTGG
        TGAACGTTTTTGGACTGTGGATGTGACCGCTCAGGACTGGCAGTCAGGCATGATGCGTTTGCAGGCCTCGCCGCCAGAGG
        GTCTTTTCTACAGAAACTATTATACTGCTGGTAGCACAGAGCCCCTGAAGGCAACCTACATGGCCTCTTGCTGCGAACCA
        AAGGTATCACTCATCGCTTTCGATGCGGCCGGGAACCAGAGAAGCCTCACCATCGATGTCAGAGATGTGTATTTGAACGA
        GGCCGCCATTGCAGCCATTTGCCTTGGAGTCATTCTCCTGATCCTGCTTATTGCAGCCCTCATATGGAGCATTGTGTGGT
        GTTGCAGACGGAGGAAGACAACGCTGGAGCTGCCCACATATAGATCCCACTCCACTAGGAGCATGGAGTAGATTGTTGTT
        ATGTTATTGTGCCAAGTTAGAACCTATGTGGTCTCGAAGTCTAATAAAATGCCATAGAAGTACCAG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0308298
        2675
        FBtr0308299
        3496
        FBtr0339672
        2365
        FBtr0344862
        2468
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0303353
        948
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0300617
        537
        FBpp0300618
        948
        FBpp0308729
        537
        FBpp0311177
        525
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG43394-RC
        Secondary FlyBase IDs
          References (0)