Open Close
General Information
Symbol
Dmel\sli-RB
Species
D. melanogaster
Annotation Symbol
CG43758-RB
FlyBase ID
FBtr0330730
Feature type
Associated gene
Evidence Rank
Length (nt)
8954
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 55 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Sequence
        TCAGACGCACGCATCACTTTCAATCGCGTCGCGTAGAGCGTCCAAAAAGAATTATAGTATAAACCAAGAGTGAAGATTCC
        GGTGAGCAAAGAATTTGCAATTGCCAAACTTAAGCAAAAACCATAAAGTGTGCATTGGCAATTGAAGTCGCGCGTTCTTA
        GCCAATCCACATTTGCACGGCCATTTTAAAGCCAAGTTAAGGCCAAAGTTTTCTGCCGCGCCGTCTTCGTAAGTCGCAGG
        TCGAAAAGTGCTCAAACGAGATTTCCACTTGAAATTCCTGAATTTCGTTTGTCTGCGCGAATCGCATCGAATCGAATTGA
        AGCACAAATCGCAGCAGCAGAAAAGCGCAAAAGTCGAATTTAAATTCCGTCTGCAAAGTGCCGAAAATTAGTGTCTTTGT
        TGTGTTAGTGTTTTGTTTCTTTGTCTGTGTGGGTGTTACGATTACGATTGGATTAGCGGTGTTTTCGCCTGATTAAAACG
        GTATGTTGAAGATTATGGCCATAAATACGACTGGTTGGGTTGGCAGAAGTTTTTCAAGAAAAATGCGCTCAGCAGGTCGC
        TGCGATGCCTTCGAGCTGGTGCTGCCGCCGGTGCTGATGATGATGATGAAGTTGCTGCCGCTCCCGGTCCGATGCTTTAG
        CTGCTGACAGCCAAGTGCAGTATCCGAAAGATACCAGATACGAGATACCCGAGACAAAGGAAAGGAAAAGTGCATTTCCT
        GCTACCTAACTTGTGCGTGCCGTTCTACCTACATAGCCGGATTCTACCTACGATTTCGGTAGGGAGTTGAAAAAGAGAGT
        AACTCGCCGCCGATACTCTCTCGCTGCTTGCTACTCGCTGCTCGGTACTCGATACTTTTGTCGAGCGCTCGACGGACAGA
        CAGACATCTGCTCAGCCGGTCCGCTCAGTTTGGTCAAGAAGCGCGTTCGCGACGGCTGCAAAAGAGCGTACCGCCGTAGG
        AAAACCCCGAGTGAAAAGTGCGCCGTGGAGCGCGGGCGGACATTCACCGAACCCAAAACGCCTCGAACTCGATATCGAAT
        CGAAAGGATTAATCCAGTGAAATCAGTGAAGTGAAAGTGCCTGCGAACGCATCATCAATCCTTTATCCTTTCTCCCTCAA
        ATATTTACCCAGTGGTGATTGCTGTTGACAAAGTGGATTGGCATATACGGGGGCCACTTTCAATTAGGCACGTTGCCGCT
        GCTTCATAAATGTGCCACAATGGCCGCGCCGTCCAGGACGACGTTGATGCCACCACCCTTCCGGCTCCAGCTGCGGCTAC
        TGATACTACCCATCCTGCTACTCCTGCGCCATGATGCGGTCCACGCGGAACCGTATTCCGGCGGATTCGGCAGCTCAGCT
        GTATCCAGCGGTGGACTGGGGTCAGTGGGCATTCACATACCCGGCGGCGGAGTGGGCGTCATCACGGAGGCCCGCTGCCC
        GAGGGTCTGCTCCTGCACCGGATTAAATGTGGATTGCTCGCATCGAGGACTCACCTCCGTTCCCAGGAAAATCTCAGCGG
        ACGTGGAGCGACTCGAGCTGCAGGGAAACAATTTGACCGTGATATACGAGACGGATTTCCAGCGGCTGACCAAGCTGCGA
        ATGCTCCAACTAACTGACAATCAGATCCACACGATCGAGAGGAACTCCTTCCAAGATTTGGTCTCACTCGAGCGACTGGA
        CATCTCCAACAATGTCATCACGACCGTGGGTAGACGCGTCTTCAAGGGAGCCCAATCGTTGCGGAGTCTTCAGCTGGACA
        ATAACCAAATCACCTGCCTGGATGAGCACGCCTTTAAGGGATTGGTGGAGCTGGAGATACTCACGCTGAACAACAACAAC
        CTGACTTCCCTGCCGCACAACATCTTCGGCGGACTGGGACGTTTGCGGGCACTCCGGCTGTCGGACAATCCGTTCGCCTG
        CGACTGCCATCTGTCCTGGCTGTCGCGATTCCTTCGCAGTGCCACCCGCCTGGCGCCCTACACCCGCTGCCAGTCGCCAT
        CGCAGCTGAAGGGCCAAAACGTGGCGGACCTGCACGACCAGGAGTTCAAATGCTCGGGTCTGACGGAGCACGCACCGATG
        GAATGCGGGGCGGAGAACAGCTGTCCGCACCCATGTCGCTGTGCGGACGGGATCGTCGATTGCCGTGAGAAGAGTCTGAC
        CAGCGTGCCCGTCACTTTGCCCGACGACACCACCGAGCTCCGCCTCGAGCAGAATTTCATTACGGAACTGCCGCCGAAAT
        CGTTCTCCAGCTTTCGACGACTGCGACGCATCGACCTGTCCAACAACAACATATCCCGGATTGCCCACGATGCACTAAGC
        GGCCTAAAGCAGTTAACCACTCTCGTGCTGTACGGCAATAAAATAAAGGATTTACCCTCGGGCGTGTTCAAAGGACTCGG
        CTCGCTGCAGCTGCTGCTGCTGAACGCCAACGAGATCTCGTGCATACGCAAGGATGCCTTTCGCGACCTGCACAGTTTGA
        GCCTGCTCTCCCTGTACGACAACAACATCCAGTCGCTGGCTAATGGCACATTCGACGCCATGAAGAGCATCAAAACGGTA
        CATCTGGCCAAGAATCCTTTCATCTGCGACTGCAATCTGCGCTGGCTGGCCGACTATTTGCACAAAAATCCCATAGAGAC
        GAGTGGAGCCCGCTGCGAGTCACCGAAGCGGATGCATCGTCGTCGGATTGAATCGCTGCGCGAGGAGAAATTCAAATGCT
        CCTGGGATGAATTGCGGATGAAGCTGTCCGGCGAGTGCCGCATGGACTCCGACTGTCCGGCCATGTGCCACTGCGAGGGC
        ACCACCGTGGATTGCACGGGCCGGGGCCTGAAGGAGATTCCGCGCGACATTCCCCTGCACACAACTGAGCTTTTGCTCAA
        CGACAACGAACTGGGACGCATCAGTTCCGATGGCCTCTTTGGTCGCCTGCCGCACTTGGTGAAGCTGGAATTGAAGCGCA
        ACCAGCTGACCGGCATCGAGCCCAACGCCTTCGAGGGAGCATCCCACATCCAGGAGTTGCAGCTGGGCGAGAACAAGATC
        AAGGAGATATCGAACAAGATGTTCCTGGGACTGCACCAACTAAAAACGCTCAATCTGTACGACAATCAAATCTCATGCGT
        TATGCCCGGTTCCTTTGAGCATCTCAACTCTCTGACGTCGCTGAACCTCGCATCGAATCCATTCAATTGCAATTGTCATT
        TGGCCTGGTTCGCGGAATGGCTGCGCAAAAAATCACTGAACGGCGGAGCGGCACGTTGTGGAGCCCCGTCGAAGGTACGT
        GACGTGCAGATCAAGGACTTGCCCCACTCGGAATTCAAGTGTAGCAGCGAGAACAGCGAGGGCTGCCTGGGCGATGGCTA
        CTGTCCGCCATCCTGCACCTGCACCGGCACCGTGGTCCGCTGTTCGCGTAACCAGCTGAAGGAGATACCGCGCGGCATTC
        CCGCCGAGACATCGGAGCTGTATCTGGAGTCCAATGAGATCGAGCAGATTCACTACGAACGCATACGCCATTTGCGCTCC
        CTTACCCGACTCGATCTCAGCAACAACCAGATCACCATTCTCTCCAACTACACCTTTGCCAATCTGACCAAGCTGTCCAC
        GCTCATCATCTCATACAACAAGCTGCAGTGTCTGCAGCGGCATGCGTTGTCTGGCCTGAATAACCTGCGCGTGCTTTCGC
        TGCACGGTAACCGCATCTCGATGCTGCCGGAAGGCTCCTTCGAGGACCTCAAGTCGTTGACCCACATCGCACTAGGCAGC
        AATCCCTTGTACTGCGATTGCGGTCTGAAGTGGTTCTCCGATTGGATAAAGCTGGACTACGTGGAACCGGGAATTGCACG
        TTGCGCCGAACCGGAACAGATGAAGGATAAGCTGATCCTGTCCACACCCTCGTCGAGCTTCGTTTGCCGCGGCCGCGTGC
        GCAATGATATTCTGGCCAAGTGCAACGCCTGTTTTGAGCAGCCGTGCCAGAATCAAGCGCAGTGCGTGGCCCTTCCGCAG
        CGAGAGTACCAGTGCCTCTGCCAGCCGGGCTATCATGGCAAACACTGTGAGTTTATGATCGATGCTTGCTACGGAAATCC
        GTGCCGCAACAATGCCACTTGCACGGTGCTGGAGGAGGGTCGTTTCAGCTGTCAGTGCGCTCCGGGATACACAGGTGCCC
        GCTGCGAGACGAATATCGACGATTGCCTGGGCGAGATCAAGTGCCAGAACAATGCCACCTGCATCGACGGAGTGGAGTCG
        TACAAATGTGAGTGCCAGCCGGGATTCAGTGGCGAGTTCTGCGACACCAAAATCCAGTTCTGCAGTCCGGAGTTCAATCC
        CTGCGCGAATGGAGCCAAGTGCATGGACCACTTTACCCACTACAGCTGCGATTGTCAGGCAGGTTTCCATGGCACCAACT
        GCACGGACAATATTGACGACTGCCAGAACCACATGTGCCAGAACGGTGGAACGTGCGTGGACGGCATCAACGACTACCAA
        TGCCGCTGTCCAGACGACTATACGGGCAAGTACTGTGAAGGCCACAACATGATCTCGATGATGTATCCACAGACGTCGCC
        TTGTCAAAACCACGAGTGCAAGCACGGTGTCTGCTTCCAACCGAACGCTCAGGGCAGCGACTACCTATGCAGGTGTCATC
        CGGGTTACACTGGAAAGTGGTGCGAGTACCTCACCAGCATAAGCTTTGTCCACAACAACTCGTTTGTAGAACTGGAGCCA
        CTGCGAACACGTCCGGAGGCGAACGTGACGATAGTCTTCAGTAGCGCGGAGCAGAATGGAATTCTCATGTACGACGGCCA
        GGATGCTCATCTTGCAGTGGAACTGTTTAATGGGCGTATTCGGGTTAGCTACGATGTGGGTAATCACCCTGTGTCCACGA
        TGTACAGCTTTGAGATGGTGGCCGATGGAAAGTACCATGCCGTGGAGCTTCTGGCCATCAAGAAGAATTTCACGCTGCGC
        GTGGATCGCGGATTGGCCCGTTCCATCATCAACGAGGGCTCCAACGACTACCTGAAACTCACGACGCCCATGTTCCTGGG
        CGGCCTACCCGTGGATCCTGCACAGCAGGCGTACAAGAACTGGCAAATACGCAACCTTACCAGCTTTAAGGGCTGCATGA
        AGGAGGTGTGGATCAATCATAAGCTGGTCGACTTTGGCAATGCCCAGCGCCAGCAAAAGATCACACCAGGATGTGCCCTG
        CTCGAAGGAGAGCAGCAAGAGGAGGAAGACGACGAGCAGGATTTCATGGACGAGACACCGCACATCAAAGAGGAGCCGGT
        GGATCCTTGCCTGGAGAACAAATGCCGTCGGGGCAGTCGCTGTGTGCCGAATTCCAATGCCAGGGACGGCTACCAGTGCA
        AGTGCAAGCACGGCCAGCGCGGCCGCTACTGCGATCAAGCGGCGTCCACCTGTCGCAAGGAGCAGGTGCGCGAGTACTAC
        ACGGAGAACGACTGTCGCTCGAGGCAGCCGTTGAAGTACGCCAAGTGCGTGGGCGGCTGCGGCAACCAGTGCTGCGCGGC
        CAAAATTGTGAGACGGCGCAAGGTGCGCATGGTGTGCAGCAACAACCGCAAGTACATCAAGAACTTGGACATCGTGCGCA
        AGTGCGGATGCACCAAGAAATGCTACTGACTGAAAGATGCGACTACCCAATTGCTCGAACGGAGCAATAGCAGCTTAGAT
        GTTAGTTTAGGAACAGGTTTAAATCTAACTTATAGTAGTAGTTATAGTAACGATAGTCTTAGCCATAGCACTAGGGATAG
        CACGGATGTTAGGGGGACGAAGGATGAAGCGGAGGAGAGTGCTGACGCGGGGGAGACAACGGAGGAGGTGAGGGACGAGA
        GTGATGATTACCCCACGGACGGCATGCAGTCCGATCTCTACGACGACACCATCGATGACGACGATGACGATGGTCTCGAT
        GATGATTATGCAGACGAGGAGGATGGGGAGGAGGATCCAGAGCAGCTTCCCGATCCCAAAGGTCTGGTAAGTGTGCCAGA
        TGAAGAGGAAGACATGGGTTACGACGAGGATGACGAACGTATCGCCATGGAGCGGCCAAGAACGGTTAGACCCAGGCCCG
        ACGAGGAGCATTTCCTTAACGAAGAGGGCAGTGGTTTCGGCGGCTTTCGATCGCGATTCCGGCCGAGCAATAGCTTCCGC
        GAGACTCAGCTGGAGAATATCCGCAAGAAGCTGCTCACAGAAGCACAGGCGGCTCCGGAAACGGCTGTTGCGGTGGCCGT
        GCCGAGCACTGCGATAGATCTGCGCGAGAGCAGCGGCCACTTTGCCAACGATGACGAGGATGGCGAGGACGGCGATGACG
        GCGTCGATGACGAGTTCGCCGACACGGGGGAGAACCAGGGGCGCGGCTTCTTTGGCTCCCAGCAGCAACAGCGCAAGAAC
        GGTCCGTATCACCGCAAGAACGGCAACGATGCCATCAAAATCATCTCCACGCCGCTGGGCAAGGTGAGCATTGTGTACCA
        GCAGACGGACAAGGATCAAAGTCCGGACAAGGATGCGCAACAGCAGCAGCAAAAGAAGCCGGCGCTCACCGACTTCGACG
        CCCTGTCACCGGACCCCGAGAGCAGTCATCGCTTTCCGTCGCCCCACCCCAAGATTACACCTGTTCTGACGCCCGATGGC
        AAGGTGGCGCTGCTCTATCGCGGAGACTCGGAGAGCTCCAAGTACGAGCCCATACGCAACCTGACGCACAAGTTTTCGGG
        ACAGCCGGCCAAGGAGTCAAAGCCTAAAACCGAAGATTCCTCCTCGGCGGAGGACTCTGTCTACACGGACAGCGAGGATA
        CCGAGGACAGTAAAGGTGAAACTAGTGCTGGAAAGTCCTCACCAGTGGCCTCCACGCCCAAGCCACTGCAGCCAGAGATT
        TTGGAGCCTCCAGATAACGTCCAGCCAGGAGGGTCATTTATAATTCGGCCCACCTCCGACTCGCTTCTGCCGATGATCAA
        CAGGCCACTGTCCGAGGTTCTGGGCATCAAGAAGAACCAGTTCCAGGAGACCCGGGTGCGTGACCAATTGCCCACGCAAC
        AGCCTCCGCCTCCACTGCCGGAGGCCACGTCCCGTAGTCCCGCTTCCGGACATCAGTTCCTAGCCAAGGTGAACCTGGCT
        GAGTTCCCGACATCCGGAAGGACGCTCCAGACGCCGCTGATCCCCAGCACCCACGACTTTGACTTCAGCCGTGACAACAC
        GATGCTGGACGAGCGGTCGCGGGTGCGTGAGTTGGAAAAGCAGCGGGAGCGGGACAAGGAGCACAACGAGGCCACCAGCA
        AGGGAGCCACCGAGGCACACACCATAGCCAACGAGCAGCTGCTCTCCAAGACGGAAGTCATCAATCTGGCCATTGTGCCA
        CAGTTTGACGAGGACTTGGAGCGTCTACAGCGGCTGCAGGAGAATGGTGGTCGGCGCCACCATAGGGCGCGACATCGTCA
        TCGGCAACAGTCGGAGGAGGAACTGTCTGGCATCCATTGCATCATGCAGGTCATGATGGGCGTGGCCGCCGTGTCGACGG
        TCTTCGGCATGCTGGGCACCTTCTTCAAGCAACGCATCCTCGATCAGCTGCGCATGATGCACTGGTAGTACAACAAGGGG
        GATTCGATTTTCGGTGTCGAATGCCCCACATCCCCCCACCCAATCCCCGTTTCCTGCATCGTCATGATCATCATGCAGTC
        TATGGAGGCTGGCTAGCTGCCTTCGGGATGCAAGGTCCTTCTTCTACTACTAGCACTCATATACTCGAATATATACTCGT
        ACTCGTACCATATGCCATATGCCATATATTAATCGCATAATCTATGTAACACAGCGGCATCGATTTGCTTTCGTCCCCTT
        CCGCTTCCTTATATATATTTATATATACATTTATATATCTATCTTATCCTTCGACATTGTGCTCGCAAATGCGGACACTT
        CCTTGCTACACATGTATTCTATATATTCGCATATATCAATTTACTAGTGCAAGCTACCCAGGCGATGTACATAATAACAG
        AACCATAATACGGCGATCGATCGATCCGGATATCTATGTATTTATGTGAGACGCAACTGTAGCCCCTGCCACACTCCGCC
        GGAAATTAGCTGACCCACGTCACTTCTTCCCCGTTCCTTCTTTCGCACGTTGTGTGCCCTATTTTCCCCTCCCATGTAGG
        ACATTCTCAATCACATCAGCGTATACAAGCTTTAAGCAAGTCATTGCATGTGCCACGCCCCCTCGAACTGAACTGAACTC
        AACGCCCAACCCGCCCAGCATGAGTCCCGCAGCAAATACATTCCCTCCATCCCCCCACCATCCGTCATCCGCCAGAGGAA
        CCAGTCGAGGAGCTCGGAAATTGAACGTAGAACAGATTCCTTTTGTAGATAGAAAACGAAACAGTTGTTGGGAGATGGTA
        ACCAGACGAATGTCGAATGACAAACGATAAATAATGATAAACTAAACTAAAGTTCTAAACAAAACAAAACACAGTAAAAT
        CGCACAGAAGCGCACGCATTACAAAATACAAAAACCTGCAACGGTCGTTTTAAACGCTCCGTTCAGTTGTCTCAAAGAAA
        CGAGTAAACGATAATAAGTGCATAACGAAAACCTTCTTTAGTCTAAGTTGCTCAAAGGATAAAGTATTTTGATAGAACCG
        GAAAGGATCGAGAAACAAACCAATAAACCACAAAGAATCGAATTGAATCGTAACGAAACAAAGGCCCCAAACGTGTAACG
        AATTTCCAACAAATTGTTGCAAGTGTTTTCCTAGAATTAGTCCTAATTAAACTAAATGTGTGCAAATCGAAGCGTAACTA
        ATATTACAATTAATCTAAACTAATTGAGGAAACATAAACCTAAACATAAATCGGATAACAACATCTAAGCTGGGTAGTCG
        CATGTAAATCTCTAACAATTAACAATTACCGACCTAAGTTAGACCTAAAAATCGAAACAAAATCGAATCGCATT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0330729
        8925
        FBtr0330731
        8997
        FBtr0330732
        9484
        FBtr0330733
        8154
        FBtr0330734
        8997
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0303574
        1469
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0303573
        1480
        FBpp0303575
        1504
        FBpp0303576
        1480
        FBpp0303577
        1504
        FBpp0303578
        2157
        Comments
        Transcriptional initiation site supported by short-capped RNA data (FBrf0209722).
        3' UTR based on RNA-Seq data.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG43758-RB
        sli-RB
        Secondary FlyBase IDs
          References (0)