Open Close
General Information
Symbol
Dmel\Lar-RF
Species
D. melanogaster
Annotation Symbol
CG10443-RF
FlyBase ID
FBtr0331239
Feature type
Associated gene
Evidence Rank
Length (nt)
8424
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 33 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      TAGTACAATTTCGGGATTTGGCAGGATGTAACGAGCGTGTAAGAAACAGAGCGCGTCCTTCTCAGCCGTGTGTGTGCGAT
      AATCGGGCAACAAGCAGCGCGACAGCAAATTGTATATTACACAAAATTCGCAAAAAATCCAACGAATCGTTTGAATCCAA
      TTTCGAGTGATATAACATAACCACAGATCGTACTCGGTTATAATGCAATAGCAAAGAGCCGCAGCATTTCGAAAATCCGG
      CAAAGTGATTTTAGCCAAGTTAACCAAAAACCAAATCGTCGAACTCCTCGGCTTGCCTCGGTTCAACCCCCTTCAACCCT
      TTCTCCATTAACTCGTTGTTGCCGCTGTACTCGTACATATGTGTGCACTTGTTTTTGTGAACGTGTTTTGCCGCAAGCCG
      GTTAAAAAATTATTCCCATAATTACACCATCCGAGTTGCAGGCGAGGAACTTCCGCGAAACATAATTACCGAAGAACAAC
      TGACGTAGCCGATAATACCTGGCGGATAAATCGGAATACCGAATGCCGAATGCCGAATACCAAACGGCACACAGCACTGA
      ATCACAGCAAAAAAAAAAAAAAATAAAACCAAATATAAATCAATAAGACAAAGAATAAACTGCATATCTCAGATTATATT
      TTAGATATATGTAAATGAAGTAGCCATAAGAGTTCATTAAGTATTAGCTTCAGACATAGTCAGCAAAAGTTTAAGTGCCA
      TTTGGCGAGTGAGTGAGTCCGTCAGCCGACGAGTAAGTCTGACAGAGACACGGCCTGTGTGTAAATAATAAATAATAAAT
      AATAAAAAAAAAGAGAATAAAAAGAGCATTTAAAGTTATTAGTAACCATCGTTGTTGTTGAGTTGTTGTTGTTGTTACCA
      ACTGTCGACATACCCTTGCAACTGCCGGCGAAAACATAGCGAAATAATGGGTCTGCAGATGACAGCAGCCCGTCCAATCG
      CAGCTCTCAGCCTACTAGTGTTGTCCTTGCTCACCTGGACTCACCCCACAATCGTGGATGCAGCCCATCCGCCGGAGATC
      ATCAGGAAGCCGCAGAATCAGGGAGTCCGAGTGGGCGGCGTTGCTAGCTTCTATTGTGCGGCCCGCGGTGATCCGCCTCC
      ATCGATAGTGTGGCGCAAAAATGGCAAAAAAGTTTCGGGAACCCAGTCGCGTTACACGGTGCTGGAGCAGCCCGGCGGGA
      TTTCCATACTCCGGATTGAGCCCGTGCGGGCGGGACGCGATGATGCACCATACGAGTGTGTGGCGGAGAACGGGGTGGGC
      GATGCCGTTTCCGCAGATGCAACTTTAACCATATATGAAGGCGATAAAACACCCGCAGGCTTTCCGGTTATAACCCAGGG
      TCCGGGAACTCGCGTCATTGAAGTGGGTCACACGGTCCTCATGACATGCAAAGCCATCGGCAATCCGACGCCAAACATTT
      ACTGGATTAAGAATCAGACAAAGGTTGATATGAGCAATCCGCGCTACTCTCTCAAGGATGGCTTCCTGCAAATCGAAAAC
      AGTCGCGAGGAGGATCAGGGCAAATACGAGTGTGTGGCTGAGAACTCAATGGGCACGGAGCACTCGAAGGCCACCAACTT
      ATATGTGAAAGTCCGTCGTGTTCCGCCCACCTTTTCCCGCCCACCAGAGACCATCAGCGAGGTGATGTTGGGATCTAATC
      TGAATCTATCCTGCATTGCCGTCGGCTCACCCATGCCGCATGTCAAGTGGATGAAGGGCTCCGAAGATCTTACACCCGAG
      AATGAGATGCCAATCGGACGAAATGTCCTGCAGCTGATCAATATCCAGGAGAGCGCCAACTACACTTGCATAGCGGCCTC
      CACTTTGGGCCAAATCGATTCCGTTTCGGTGGTTAAAGTGCAATCTCTGCCCACCGCACCCACCGATGTGCAAATCTCCG
      AGGTGACCGCCACTTCGGTGCGTCTGGAGTGGTCGTACAAGGGTCCCGAGGACTTGCAATATTACGTGATCCAGTACAAG
      CCGAAGAACGCCAACCAGGCCTTCAGCGAGATAAGCGGCATCATCACCATGTACTATGTGGTCCGTGCCCTGAGTCCCTA
      CACGGAGTACGAGTTCTACGTGATAGCCGTGAACAATATTGGACGCGGACCGCCCTCGGCACCAGCGACATGTACCACCG
      GCGATTTCTCATTCGGTGGCACAAAAATGGAAAGTGCACCACGTAATGTCCAAGTGCGTACGCTGAGCTCGTCCACGATG
      GTTATTACTTGGGAACCACCAGAGACGCCCAATGGACAAGTGACCGGCTACAAGGTGTACTACACGACCAATTCGAATCA
      GCCGGAGGCGTCGTGGAACTCCCAGATGGTCGACAATAGCGAACTGACCACAGTCTCGGAGCTGACGCCCCACGCCATCT
      ACACGGTCCGGGTTCAGGCCTACACATCGATGGGAGCCGGTCCAATGTCCACGCCGGTCCAGGTGAAGGCCCAGCAAGGT
      GTGCCATCGCAACCGAGCAATTTCCGGGCAACCGATATCGGCGAGACCGCAGTCACACTGCAATGGACCAAGCCGACGCA
      TTCCAGCGAGAATATCGTGCACTACGAGCTCTACTGGAATGACACATACGCCAATCAGGCCCATCACAAGCGCATTTCCA
      ACTCGGAGGCGTATACCCTGGACGGACTCTACCCCGATACCCTCTACTACATCTGGCTGGCTGCAAGGTCGCAACGTGGC
      GAGGGGGCCACCACCCCGCCCATTCCGGTGCGCACCAAGCAATATGGTGCTCCGCCTCGAAATATCACCGCCATAGCCAC
      CAGCTCGACGACCATATCCCTCAGCTGGCTGCCTCCGCCCGTCGAGCGATCGAACGGCCGGATCATATACTATAAGGTGT
      TCTTCGTGGAGGTGGGTCGCGAAGACGACGAGGCCACCACCATGACCCTCAATATGACCAGCATTGTACTGGACGAGCTG
      AAGCGCTGGACAGAGTACAAGATCTGGGTGCTGGCCGGCACCTCCGTCGGGGATGGGCCGCGGTCGCATCCCATCATTTT
      GCGCACCCAAGAGGATGTGCCCGGCGATCCGCAAGATGTGAAGGCCACACCTTTGAACTCCACTTCGATCCATGTCAGCT
      GGAAGCCGCCTCTCGAAAAGGATCGCAATGGCATCATCCGTGGGTATCATATACACGCCCAGGAGCTGCGAGATGAGGGC
      AAGGGCTTTTTGAACGAACCCTTCAAGTTTGATGTGGTAGACACGCTGGAGTTCAATGTGACTGGCTTGCAGCCGGATAC
      AAAGTACTCCATTCAGGTGGCGGCACTAACTCGTAAAGGAGATGGTGACCGGAGTGCTGCGATTGTGGTGAAAACTCCTG
      GCGGAGTACCAGTTCGACCAACGGTGAGTCTGAAGATCATGGAGCGGGAACCGATCGTGTCCATCGAACTAGAATGGGAG
      CGACCGGCGCAGACCTATGGCGAATTGCGTGGCTATCGACTTCGATGGGGCGTCAAGGACCAAGCACTGAAGGAGGAGAT
      GCTGTCAGGACCGCAGATGACCAAGAAACGGTTTGATAACTTGGAACGCGGAGTTGAGTACGAATTTCGTGTGGCGGGCA
      GCAATCATATTGGTATCGGGCAAGAGACGGTGAAAATATTTCAGACACCCGAGGGAACACCCGGTGGACCGCCTTCTAAC
      ATTACCATTCGCTTCCAAACTCCGGATGTACTGTGCGTGACCTGGGATCCACCAACTAGGGAGCACCGGAATGGCATAAT
      CACCCGCTATGATGTTCAGTTTCACAAGAAAATCGATCATGGCCTGGGATCCGAGCGAAATATGACTCTCCGGAAGGCGG
      TGTTCACAAATCTGGAGGAGAACACCGAGTATATCTTCCGGGTGAGGGCTTATACGAAGCAGGGAGCTGGTCCCTTCAGC
      GACAAGTTAATCGTGGAGACAGAACGTGACATGGGTCGAGCACCTATGTCCCTGCAGGCAGAGGCAACATCGGAGCAAAC
      TGCGGAGATTTGGTGGGAACCGGTAACAAGTCGTGGCAAGTTGCTGGGCTACAAGATCTTTTACACCATGACAGCTGTCG
      AGGATCTGGACGATTGGCAAACGAAAACCGTTGGACTTACGGAATCCGCTGATCTTGTTAATCTCGAGAAGTTTGCCCAA
      TATGCCGTGGCCATTGCGGCGAGGTTCAAGAACGGATTGGGACGTCTTAGTGAAAAGGTTACAGTACGCATCAAGCCGGA
      GGATGTGCCCTTAAATCTTCGCGCTCACGATGTCAGCACCCATTCGATGACCTTGAGTTGGTCGCCACCCATTCGCCTAA
      CCCCGGTAAACTACAAGATCAGCTTCGATGCCATGAAGGTGTTTGTGGACTCGCAGGGATTCTCCCAGACCCAGATCGTT
      CCCAAGCGAGAGATTATCCTTAAGCACTATGTGAAGACCCACACTATCAACGAACTCAGTCCGTTTACCACGTACAATGT
      GAATGTGAGTGCCATTCCCTCGGATTATTCCTACCGGCCGCCCACAAAGATTACGGTCACAACGCAAATGGCTGCACCTC
      AGCCAATGGTGAAGCCGGATTTCTACGGCGTTGTTAATGGCGAGGAAATTCTGGTGATACTGCCTCAGGCTTCGGAGGAA
      TATGGACCCATATCGCACTATTATTTGGTGGTGGTCCCGGAGGACAAGTCCAATCTGCACAAGATACCCGATCAGTTCCT
      TACCGATGATCTCTTGCCGGGCAGGAATAAGCCAGAGCGTCCGAATGCACCGTACATTGCAGCCAAGTTCCCGCAGCGTT
      CCATTCCGTTCACATTCCACCTGGGATCTGGCGATGATTATCATAACTTTACAAATCGCAAATTGGAGCGAGAGAAGCGC
      TACCGCATCTTTGTGCGAGCGGTTGTGGATACGCCACAGAAGCACCTCTACACCTCCAGTCCCTTCTCTGAGTTCCTATC
      GCTGGACATGAGGGAAGCTCCGCCAGGTGAGCGGCCCCACCGACCCGATCCCAATTGGCCCGCGGAGCCGGAAGTGTCGG
      TGAACCGCAACAAGGACGAACCGGAGATTCTGTGGGTGGTGCTGCCCCTGATGGTGTCCACATTCATTGTGTCCACCGCC
      CTGATCGTTCTCTGTGTGGTTAAGCGTCGTCGCCAGCCGTGCAAGACTCCGGATCAGGCAGCTGTCACAAGGCCACTGAT
      GGCCGCCGACCTGGGAGCCGGACCTACGCCCAGCGATCCCGTGGACATGAGGCGCTTGAACTTCCAGACACCCGGCATGA
      TCTCCCATCCGCCCATACCGATATCCGAGTTTGCCAACCACATCGAACGACTCAAGTCCAATGACAATCAGAAGTTTTCG
      CAGGAATACGAAAGCATTGAGCCGGGCCAACAGTTCACCTGGGACAACTCCAATCTGGAGCATAACAAGTCTAAGAATCG
      CTATGCAAATGTTACCGCCTACGATCATTCACGCGTCCAGTTGCCAGCGGTGGAGGGTGTGGTTGGATCAGATTACATCA
      ATGCCAATTACTGTGACGGCTATCGGAAGCACAATGCCTACGTGGCGACCCAAGGTCCGTTGCAGGAGACCTTTGTCGAC
      TTCTGGCGCATGTGTTGGGAACTGAAGACGGCAACCATTGTGATGATGACGCGATTGGAGGAACGAACGCGCATAAAGTG
      CGATCAGTATTGGCCCACTCGCGGAACGGAAACCTATGGTCAGATCTTTGTTACCATCACGGAGACACAGGAACTGGCCA
      CCTACAGCATCCGCACCTTCCAGTTGTGCCGGCAGGGCTTTAACGATCGGCGTGAGATCAAGCAGCTGCAGTTCACAGCC
      TGGCCAGATCATGGAGTGCCCGATCATCCGGCGCCCTTCCTTCAGTTCTTGCGCCGGTGTCGCGCCCTCACGCCACCGGA
      ATCCGGACCCGTGATTGTTCACTGCTCTGCGGGAGTTGGTCGCACTGGCTGTTATATCGTAATCGATTCAATGTTGGAAC
      GAATGAAGCACGAGAAGATTATCGACATCTATGGGCATGTTACTTGTTTACGGGCGCAACGGAACTACATGGTGCAGACG
      GAGGATCAGTACATCTTCATTCATGACGCCATCCTGGAGGCCATCATCTGTGGGGTGACGGAGGTGCCGGCTCGCAATCT
      ACACACCCACCTACAGAAACTATTGATCACGGAGCCCGGCGAGACCATCTCGGGCATGGAGGTGGAGTTCAAGAAGCTGT
      CTAACGTCAAGATGGACTCGTCCAAGTTCGTAACGGCCAATCTGCCGTGCAACAAGCACAAGAATCGCCTGGTCCACATT
      CTGCCGTACGAGTCAAGTCGCGTCTACCTGACCCCCATCCATGGAATCGAGGGAAGCGACTATGTCAACGCCAGCTTCAT
      CGACGGCTATCGTTACCGTTCCGCATACATCGCCGCACAGGGTCCTGTCCAGGATGCCGCTGAGGACTTTTGGCGCATGC
      TCTGGGAGCACAACTCCACCATTGTGGTCATGCTGACCAAGCTCAAGGAAATGGGAAGGGAAAAGTGCTTCCAGTACTGG
      CCTCATGAGCGATCCGTACGCTATCAGTATTATGTCGTGGATCCCATTGCTGAGTACAACATGCCGCAGTATAAGCTGCG
      TGAATTTAAGGTCACGGATGCCCGAGATGGCTCATCGCGCACCGTCCGCCAGTTCCAGTTCATCGATTGGCCGGAGCAGG
      GTGTGCCCAAGTCGGGCGAGGGCTTCATCGACTTCATCGGACAGGTGCACAAGACCAAGGAGCAGTTTGGCCAGGATGGA
      CCCATTACCGTGCACTGTTCGGCGGGCGTGGGACGTTCGGGTGTCTTTATCACTCTGAGCATCGTTCTGGAACGAATGCA
      GTACGAGGGAGTACTGGACGTCTTCCAGACAGTGCGCATACTGCGATCCCAGCGTCCGGCTATGGTACAAACCGAGGATC
      AATACCACTTCTGCTATCGCGCTGCACTGGAGTACTTGGGCTCATTCGACAATTATACAAACTGAGTGCATTTCTCAATG
      GGATTGCCAGGTCCACAGAGCTAAAATCTCATCGACCCTGCGTTCGTTGCATACTTATTTCGAACTCTACGCATAATACG
      CATTTACGATATACACGGATATCATAACTCTAAAGTATTATAGCCAGCTACTGCCCACACTTACTTAATACACCTATACT
      TATATACGTGGATATGTTTAGTTGATAAGCGCACCCCCGCCCGCAGGTTATGTTACCATTACGATTCTTTGGGGGACTCG
      ATCTTATATATTGCGTTCTATTTTATTGATAATGTAAACTAAAGAAGACTGTTACACGTTTAATTATCAAAACCTTATAT
      ATCAACCCACATGCACTTCTATGTACGAGTATGTGCATCAAGATTTGCTCGCTAATGGAGAAGGATGTCAATCAACTTGT
      TGTTGTTCGTGGTACTGCCGCCGGAGTGACCATGAATGAGGGGCGCCACTGGAAACCGATACATATTTGAACTAAGGACT
      TGGTAGCTATTAGTCTTACCGCCTAAATCGAATCTCGAACGGAAGCAAAGGGTCGAAAGTAGAAGCCATTTTAAGTAAAT
      CGAAAACTTCTGGCGATTTGGCGCAAACTCCAGACGCTATTATAATATATAATACAATCAATCAAACACTGCTATGTTAA
      TCAGTTTTCATGCCTTGGTTAATGGAAACCAGTATAAACGGTCCGTGCAATTAGTCAAAAGTCTTGCATAGCGCATATTT
      TATAAGGCAGCTAGATTCTAAAATTAGTTTTCAAACACAACTTACGTTTTGATCTCCCCGCAAAAGATGACGAACCTTAT
      GGACTGATCGATGTCTTGGTAGCTAACAGACAGTTCAAATTTCAAAGACCATTATGATAGATCACATACGCAACTTCCAG
      CCAAGCAGCTATTTTAACTTCAACCTCATTCCCTCGACTTCTATTCAGTTCCCTAGTACATTCCTGTATATACCACAGTC
      GATACCCGAGCTAGCCACTTATGTATGTGTAATTTAGATTGAAAAGCTATGAAAAGTTATTGTACCTAAGGTGTATGAAG
      ACATAGAGAATAACCGAGCGAACAGATTAGAATGATAACTGTAGATATGTACTGTAGCATATAATTTTTACCATAAAATA
      GAGCGACACACGCGGTTATAAATAAACATAAACATAAAATCGAGACATTGGCAATAGTTCTTAAGGTACATAATAATGTA
      TATAACTGATAAGCTGTTTTGCAAAACGTTTGAATTCGGCCTCGTAACTATACATAAATATATAAAGAGTTAGCAAGCAA
      ATGCTTAAAAGCAAACACTAAATTATTAGCTGAAACACATGTTAAACAACCATAGTCATATGTAAACTAAATATTTATAC
      GAAATAAAGGTATTTGTTATAACT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0081260
      7606
      FBtr0112800
      8456
      FBtr0305950
      7355
      FBtr0331240
      8637
      FBtr0331241
      7782
      FBtr0331242
      8494
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0303681
      2032
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0080801
      2029
      FBpp0111712
      2011
      FBpp0297092
      1912
      FBpp0303682
      1935
      FBpp0303683
      1927
      FBpp0303684
      1941
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      Monocistronic transcript; alternative dicistronic transcript(s) exist.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      Lar-RF
      Secondary FlyBase IDs
        References (0)