Open Close
General Information
Symbol
Dmel\CG18507-RD
Species
D. melanogaster
Annotation Symbol
CG18507-RD
FlyBase ID
FBtr0331333
Feature type
Associated gene
Evidence Rank
Length (nt)
2041
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 21 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GGCAGTTCGACGTGAACTCGCGAGCGGCCAACACGTAAGCGGCGCGTTGTGCAGCTGTTTAAAAAACTCGGCAGCAAAAT
          AACAAAAAAAAAAATACAAACCCCAACAACAGCAACCAACTCGATAATAGGCAGCGGCGCAACTGAAGTGTGAATTCATA
          TTGAGGTTATGTAACGCCATATAGTGTAAAATAAGGCGAAAACAAAACGCACTAGCTGCATTAGTCAGGTCACACGCTCA
          CCTGCAAAAATTCAGATAATTCCAAGCACGCGCATCGATTCGGTCTTATTACGCATTCGCAATGGAGGACACAAAAGCTC
          CAGCGGCAGCGCAGGCGCAAAGTCATCCTTTGGAGGATGTGTCCCTCAATGGGAACGATGACGACAAGCAGACGCCCAAA
          AATTGGGTTAAATTCGACGACGAAGCGGATAGCGGTGAAAAAAACAATAACAGTAACGACGGCGATGCCACACAGCAGCA
          ACAACAACAAAACAAGTTAACTCTGCCGCCACCGCCGTCGGTGGTTAGTAGCAACAACAACAGGAGGGCGCGCTCGCGCA
          GTCCGTCCGCTACAGTAACAACAACCACACCTGTCCAGCGCCCGGCAGTTTCCTCGACCACAGCTGCGACACCGGGCGAA
          GTGCAGCCGCATGCCCCTCCGCCGGATGTGGCGCCCGCTGTTCTGACAACCGAGAGCACGCACGTTAATCTGAGTGCATC
          CGGCAGTGGCATCGTCAGCGGAGCAAGTGCGAATGCAAGTGCGAGTGGATACGCACCTGGCCCGGTCCGCCATACCCCGC
          AGCTACCAAACCAAAAAGCCGCCGCCGCCCCCTCTCTATCGTCCGCTGGCGCGGCATCCTCCGGACATCAGCATAATGGA
          GGTGGCGCCAACGGAACTGGAATTAGCCAGCCGGCGGACCAGGGATCCGGGATGCGCACAATCGAATTGTCAACGGGTCG
          TATACGCGAGGGATTCGCAAATGGCGATGTGATTGTCACACTTCTGCCGGCCAACACGAAGTGGCCGTGGATAACCCCAG
          CCATATTCCGTCCGGAACTGGTGCCCGAGGAGCTGATGGCTCAGGGTCTGACGCTCACTGTGGAGGACTATGTGAACGCG
          ATGGAGACGCTGGTAAACGACTACCGCTTCACCGTGTACAACATCTGCTACAAGCGCATCCTGGTCTGCTGGATCCTGTT
          CGCATTTACGGTTTTGCTGGCCCTGCTCTTTTCCGGACTGCAGGGTGTGGCCCTGTTCGCCCTGGGAGTGGGCTGGCTAT
          TCCTGAACGCGGCGGCCATCTTCCTGTGCATGTGGGTGAAGCTGCGCTTGTCGCGCGGCCTTGAGAAGTGCCTGGCAAGA
          GTGAACCGGCAGCTAATGCGCCACAAGATCCTGCTGGTGCTGGACGATCGGGGCCGCATCTCGTGCCACAAGGTCAACCT
          GTGCTTCATGTACTTTGATGCCACACAGTGCGTTAATTTCCTGAACGAGTTCCTGGAGCATACGGAGCAAACTGGTGGCG
          ATGCCATCAAGGCGGGCTGGGAGGCGAAGCTGGACATTGACCTAAACGATATTGTTATCCAGGGCAGTCAGCCGGTGCGA
          ATGCCCCGCAAGCAGGAGCGCGGCCTGCAGCTGTTCCTGCGCTACGGATCCCGATGGGGCATGGAGGCCCTGAGGGGCCT
          GGTGGACGTGACCCCCTTGGAGCCGGGACGCCACTGCGGACAGTTCCAGTGCCCCTGCCAGTACATCAAAGAGCACCTGC
          AGTGCAAACCGCGAGGTTATCCATGTGGTTGCATTGTCTATGGTTCGGATCCCAGTTTTCAGTATCGTTACTAGATATGT
          TCAGCCTCATTTTATCATTTAACCCAACTATCGGAACTCAGTGTGTGTTCAAAATGTGCAGTTTTTAAATTGAATATTAT
          GTAAGGTTTGCCAAATAAATAAACAGTTCTTCCGCATTTTCAGTTTTCCTGCAAAACGTAATAATTGCCGAGACGGCACA
          AATTTGTATATAGCATATGAAACTTACCTAAATGCACATCA
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0080527
          1915
          FBtr0080528
          2425
          FBtr0331332
          2404
          FBtr0331334
          2004
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0303751
          510
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0080105
          514
          FBpp0080106
          513
          FBpp0303750
          499
          FBpp0303752
          510
          Comments
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG18507-RD
          Secondary FlyBase IDs
            References (0)