Open Close
General Information
Symbol
Dmel\CDase-RF
Species
D. melanogaster
Annotation Symbol
CG1471-RF
FlyBase ID
FBtr0331357
Feature type
Associated gene
Evidence Rank
Length (nt)
2336
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 20 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CCAGCTTGTTCGTCTTGAAGATTTAAGTTAAGTGCTCCATTTAACAATGGCTAATAGCAAGATGGCCTTCTTGGCCTTTC
          TGGCCGTAAGTTTCCTGTGTGGATTGGTTAGTGCCACCTACAAAGTGGGCGTGGGCCGCGCGGATATCACAGGACCTCCA
          GTGGAGATCAATTTCATGGGCTATGCCAACATCAAGCAAGTGGGTCGTGGCATCCACACCCGTGTCTTTGCCCGTGCCTT
          TGTGGTGGAGGATGAAAAGGGCAACCGAGTGGCCTTCGTGAGCGCAGATGCCGGAATGATGGGCTACGGATTGAAGAGGG
          AGGTGATAAAACGACTCCAGGCACGTTATGGCAACATCTACCACAATGATAATGTGGCCATCAGTGGCACCCACACGCAC
          GGTGCTCCTGGCGGATTCCTGATGCATCTGCTCTATGACATCTCCATTCTGGGCTTTGTGCCTCAGACGTTTGAGGTGAT
          GGCTCAGGGACTGTATCTGTGCATCAAAAGGGCGACGGACAACCTGGTGGATGGTCGCATCTTGCTGTCCAAAACTACTG
          TGCTAAATGTTAACATCAATCGTTCGCCCTCATCCTACTTGAGGAATCCCGCCGAGGAGCGTGCCCAATACGAGCACGAT
          ACGGATAAGACACTGACCCAGCTGCGATTTGTCGACCTGGAAAACAACCTCCTGGGCGCTTTCAACTGGTATGCGGTGCA
          TGCCACCTCCATGAACAATACCAACAGACTGGTGACCAGCGACAATGTGGGTTATGCCGCCCTGCTCCTGGAAAAGGAGT
          ACAATCCGAACAAGATGCCCGGAAAGGGCAAGTTCGTGGGTGCCTTCTGCTCATCCAACCTTGGCGATGTGTCCCCCAAT
          ATAATGGGTCCCAAGTGCTCGATCTCCGGCAATGAGTGTGATCTACTGACCTCCCGTTGTCCCACTGGCGAGGGAGATTG
          CTTTGCCTCCGGACCCGGTAAGGATATGTTCGAAAGCACCCAGATCTTGGGTCAACGTCTGGCGGATGCTGCTCTGGGAC
          TGCTCAACGAACAGAGCCAGGAGTCCACGGCACGGGAGGTCACTGGAGATGTGAGGTTCATCCACCAGTTTGTGGACATG
          CCCAACTACAATGGCAGCACCTACAATCCGCTGAGCAGGAAGGTCGACAAGATCAGGGGATGTCAGCCGGCCATGGGCTA
          TAGCTTTGCTGCTGGTACCACCGATGGACCTGGAGCCTTCAGCTTCGAGCAGGGAACCACCACGGACAACCCCATGTGGA
          ACTTTGTGCGCGACTTCATCGCTGCTCCCACGCAGGAGGACATCAAGTGCCATGAGCCCAAGCCCATTCTTCTGGCCACC
          GGCAGGGCCACCTTTCCCTATGAGTGGCAGCCAAAGATTGTCTCGGATCAGCTACTAAAGATCGGCGATGTGATCATAGC
          CGCCGTGCCCTGCGAGTTCACCACAATGGCAGGACGTCGTCTGCGAAACCAGATTCGAGCAGCTGCCTCCGCCGTCGGAG
          GCATCGACACCGAGGTAATCATCGCCGGACTGACCAACATATACACCAGCTACACGGTGACCCCGGAGGAGTACCAGGCG
          CAGCGTTACGAGGCCGCCTCCACGATCTTCGGTCCCCATACCCACTCCATTTACATGGACGTCTTCGAACGCCTGACCAA
          GGCCATGATGCGTAATGAGACCGTGGATGCGGGTCCAAGTCCGCCGTACATGAATGATGTGATGCTATCGCTGAACACCG
          GGGTTCTCTTCGACGGACATCCCATAAACACCGACTTTGGCTACGTGAAGTCGCAGCCCAACAAGGAGTACGGCATCAAC
          GAGACGGTGAAGGTCACCTACATATCCGGAAATCCGCGTAACAACCTCTTCACCGAGAAAACCTACTTCACCATTGAGCG
          AAAGATCAACGAGGATCGCTGGAAGGTGGCCTATACGGATGCCAGCTGGGAGACCAAAATGGTCTGGCACCGAACCAATA
          CGATCCTGGGCTTCAGCGAAATGGACATCTACTGGGACATCAGTCCGCAGACTCTTCCCGGGGAATATCGCATTCGCCAT
          TCCGGGGAGTACAAGTACATCCTGGGCGGAAAGTATCCCTACGAGGGACTCACGCATTCCTTCACCGTTAAGGAGGACTA
          GGATTAGATATCCGTGTGGAGTGATTTTATAAATATTCCTGGCCAGACAGTTGTAGGGCCCATCAAAAACAAAATCAACA
          CTGAATCCATGTATTTATTTACCATTTGTAAGTGACGAAGGAAAAGCTTTATTTTTGCAAACGCGAATAAAAAAGATGCC
          AAATTATGTTGAAACT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0085646
          2639
          FBtr0085645
          2372
          FBtr0085647
          2744
          FBtr0085648
          2740
          FBtr0085649
          2875
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0303775
          704
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0085008
          704
          FBpp0085007
          704
          FBpp0085009
          704
          FBpp0085010
          704
          FBpp0085011
          704
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CDase-RF
          Secondary FlyBase IDs
            References (0)