Open Close
General Information
Symbol
Dmel\CG12768-RC
Species
D. melanogaster
Annotation Symbol
CG12768-RC
FlyBase ID
FBtr0331397
Feature type
Associated gene
Evidence Rank
Length (nt)
2214
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 2 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          AGTTGTGGCAAGGCCCTCGAGCAACTCGCAACACAACACATAACAACAGCATCCCCAATAAGTGGCAGCAACTACGCCGC
          ATGGCAAAGCACCAACGGCCGCATTTGTTGTTAATTGAAATAAATTGAAATAAATTCCCCGACTTTGCTGCTCATATTGT
          TAATAAAGAGAAGCCGGAGCGACGCAACAGCGAATCAGCAGCAGTAAACAAAACTGTGAGCAAAAGGTTTTAGTTCCATT
          CCAGGCGTCAGACGACTTTGAGTACAAGCGACAAACAACCAGAACATCTAAGGAATTCCGAGCGAACAATGTGAATAATC
          GCAGCATCCGGCGACACAGGACATGCGCAGTGGCCTTTTTGGTAGTTGCATTTCGGCCAACAGCGACTGAAAGAGCAGAG
          AGCGGAGGAGCATGGCCTTTTCCCGCCACAACATCGAGAAGCGCCGACTCATCGAGCTCGTGCGACTCAACCCAATCCTC
          TGGGACTGCCGCCTGCCACACTACAAGCGTTCGGACAAGCGAAAAGCCATCAAATGGAACGAGTTGGGGCGGCTCTTCAA
          CGTTAATGGCGAGCGGGTGCAGCGCACGTTTACTTCGCTCCGCGAGATCTTCCGCCGCGAGCTGAACCACGAAAAGATGC
          TGGGCACCACGCGCTTCAAGTCCAAGTGGGAATACTACGATGCCATGGCCTTCCTCAAGGAGGTCATTCGGGAACGCAAA
          TCTCGCGAGCGCATCAAGCACGGCTCTTTGGATTCAGCACCAGTAGCCACAGGCAGCAGCAACAATAACAACAACTGCGT
          AAGCCGCAATAGCAGCAACAACAACAGCAGCAGTGCGGCCCTAGACGAATATCAGTACTTTGCTCCTAGCGACCCCAACA
          ACCCGAACAATCAGCCCCAGCTGCAGCCCGAACCAAAGAGTAGTCTGCCAGTGACTATTCCCAGTCTAAGTCTCACCCTC
          AGCCAGTTGCCGGTGGCTCTGCAGCAGCAGGCCCAGCATCTCCAAGCCTTACAGTTGCAACCGGACGTGACGCTGACTTC
          CCTGCAGAAACAATCTTTACCCACTTCCCTTACCAATGCCACACCCGCGCCCTTAGCACAAACCTCGCCCGCCCAGGTGC
          TGTCCAGCTCGCGCTCATGCAGCTCTTCGCCCTCCATCTATATAAAGGACGAGCCGTGTTCTCCGGCAGGGGGTTGTCCG
          GAAGAAGTGATGACCGGAAATGGACCAGAGGCGACAAGGAAGAAGCTGGCCACAATTCGTCCGCAGACCAAACAGCAACT
          TAAAGCGCGTCTGCAGCTGCCCACGCCCAAAAACTCATCATCGTACGCTACGTCGCCGCCCCATTTGATCATCAATGCCA
          ACAACGAGCTTATTGACACCGACGCCGGGGACCTGGAGGAGGATCTGGACGACTTCGACGAGGACGACGACGTGACCGGA
          CGCTGCTCACCAATCGTCGGCCAGTCGGAGACGATGGGTGCCGACGGCAGACTTTCGGTCGGAAGCATTTATATCGGTGA
          CGGTGGCGACTGCGGAAGGGGTATGGGTAGAGCCCACACTCAGGCGCGACACGTGCCTACCTCCAGAGAACTGCTCTACA
          TGAAATTCGGTGACTTTCTGGCCGCCAGATTGAACACTTTGCATGAGACTGTAGCTAATGAGCTGATGAACAAGATGCTT
          CTGCTAATTGCAGAGAAGTGAGAAAAGCGGGGACCGATGTCGCCTCTAAAATTATTGAATTTAGAGTTGCGTAAGGTAAG
          TGCATTCAAATATGGAAATGCCATCTTACACAATCAGCTATCAAATAAAAGCGTGTAAGTAAGATTGCCTCGGCAAGCTG
          ATGCTTTACAAATTACGGATGACTACCGAATAAGAAAAGAACACTTTGATTTCTTTTCTATGATTTGCAAATAATTTTTT
          GACTTCGCCTACTGCAGCTATATTATAAAGTCGTCCGATTTCGATCAAGTTATACCAATATATTGTTAAAAATATGGATC
          ATACCGAAAACTAAGGGAAGTACAGTTGTGTATTTCAAAAGCTCATATTGTGGCTATGTAATATAGTTGTCCAATCCCGT
          TCCAACTGAAATACAAACTGGCAATAGAAGGACTTACATCTGGTTTTAAAGTTTAATATAACAAACTCATTACGATGTTT
          ATAAAAATTAATTTTAAAAACAGCCTTTTCTTTAATAAATAAAGTAAAAATATG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0078560
          1689
          FBtr0331396
          1960
          FBtr0331398
          1855
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0303814
          429
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0078211
          429
          FBpp0303813
          429
          FBpp0303815
          429
          Comments
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG12768-RC
          Secondary FlyBase IDs
            References (0)