Open Close
General Information
Symbol
Dmel\CG43783-RA
Species
D. melanogaster
Annotation Symbol
CG43783-RA
FlyBase ID
FBtr0331516
Feature type
Associated gene
Evidence Rank
Length (nt)
4052
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 27 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      AGAACTTACAATAAAATAACCAAAAACAAATTCAAAATTTCAGATCCGGCAGCATTGAAGGTGTATCACCGACGTCCAGC
      GGTCCAAGTATCATATCCACATTGTCGACGGCCAGTGCAGCAGGTGGAGGAGGCAGCTCCGTGGGCGGAGCTGTCGCCGC
      TGGCGATAGCAACTCCAGCGGTGGCACCTGGCGACTAATTAAGGGCAAGGTCACACAAACCATCGAGGAGATCAAGTCCT
      CAAAGCTGCCACCAACTGCAGCCATACCTATTATAGTAGCCGATCCACCATCAACAGGCTGGAGCAACGATCCCGACTCG
      GACACCGAGTGCCTCACCGTGAACACATCCATTAGTGAGGAGCTTCCCCTGGACCTGGAACACAAACAGAACTCCGATTC
      GGACGTGGAGGCCGAGCTGCTGCAGCACGATAGCATAAGTTTGGGCAGTGGCGACGTGCCAACAGTGGCAGCCACTGGCC
      ACTCGGAGCGATCTCGTCTGCGACGTGGCCTGGCCCACATTCGATCCAAGGTAAAGGCCAAACAACAAGCGGCACCGGCC
      ATGAACAAAAAAGATGTCAGTCCCAGTGGTTCAACAGTGCCGGCAACATCGGTGCGAACCGGTTTTCTGCGGCGGCGCAA
      TGTGGTGGAGGCGGGCAGCGAGCCTTCCACTAGCCAGCAGGCGGAGATTGCTATCGCCAGTGGCAAGGTGAAGAAACGGG
      GCATCCTGCTGGCCCGCAAGGACGTGGAGATCGAGTCCGGCGTGGAGGTGCTCGAGGATATGATTCCTTCAACTGCAGTG
      CACATCGATCACTCAAAGGATGTCGCTAATAAGCGAGCGGAAGAAGTGACCGATGCTGGAGCTGATGCCGATTCTCGAGC
      TAGTCTAACTCTTCCTGTGGCGCCGGGCTTTAGTACGCTTGCCAGCTCATATGTGGAAAAAGAATCAGGTGTTCGGGACA
      CCAGGAGCAGGATCAGCTTCTTCTCCAACTTAAGCATGCTCAGTGTTTCTCAGTGGCGAGAGAAGCATCAGGGCGCCACG
      GCATTTGCCTTGCCAGTGCTTCTTTCCGTCTTACTGATCTTACTGATGATTTTGCCAGTGCCCGATTTTCTGCGAGGAGT
      CTTCGCCACCCTCTTGTTCTTCACGGTTATGGACTGTTGTGGTGGTCATTTGAGAGCTTTGCTCGAGGACTTCATGCTGA
      CCACGCATCCGGAACGAGTGGCCTTCGCCATTCCCAATTACAAATTCATGCCGATTTGCGAGATTCCTGCCGTTGAGGAG
      CACAAGACGATCAAAACATATGCGGGATGGATGAATGAGATTAACAGCTATGACCCCAACACGTTCTCCTTTAGCCTCAC
      AAGAGCGGTTTATGTGCGTTTGGATGGCAGTATCCTAAAGATGTCGGGTACAAATGCCCGCATACCCAAGCGACGCATGT
      GGAACGAGCCGCCAATCGATCGTCACAAGATCCCGTTTACGGATCATCGTTCATATGATCTCAGAGACTGCCGGATAGAA
      CTACTGCCTTTGGGTCTCGCCAATAAGCGTTTCTTTAATCGCAAATATCCCATACAACTGATCATCAAGAGTAACAGGGA
      TGTGCCCGATGAGCAAAGCTCCGTTGAAAGCCAGTCAGAGGCAACGGTTAAGACGGATGCCAAAGAAGCTAAAGCTGCTT
      CATCATCGGGAACTACACCACCCGGAGGAGAGGAGGAGAAGTTAGTGGACTTTGCGGGCACGGTTATGCAGGCAGATTTA
      CAGCAACTGCGGAACACGGTTAATCCGGATAAGGAGCTCAACGACATTACCGTGCCCTGTGGCGATGAGGTGCGTTTACT
      GCTCTTCTCGAGATGTGATCGGGAAAAAGAAGACTGGTATCGACGCTTCACAAACGCCAGTAGGGGCTTAGTTCACGAAC
      AGGACCTTCAGGTGCCAATGGCCCGATTCGTGGAGGATTCTGATCTTCAGGCGGCGGCAGCTAGACAGGCTTTGCTTCTG
      GTCACTGGAATGGGAAAGGCTGGCGTCAAGTCTGAAGATGAAATTTCGGCTGGGAAAGGTAATGATGAAACAGATCAGCA
      GACGCCAGATGGGCAGTTTGAGACTATCACCGAAGAGGATTTACTCGACACACCCAAGGAGGAGTCCTTCGATGGCATGA
      TCATGAGTGCCAATGTGGCCAGGAATTCGCCAGACTACGTTCGATTCATGGCCGTTTACCAGTCTCGCCGTGCCAAACGT
      CAGGAAGATGAGCTGTGGAAGGGCATTGATCAGTCGCTGTTCTTGGGTCCTTCCGGCAGCATTGTGTGGGCTAATGTACT
      ACTGGGACGATGCCTATACAGCTGGCTACACGATGCCATGCTGCACGAGAAGCTCAAGGAGGTTTTGCAAAAGAAATTAA
      ACTCTATTAAGCTGCCCAGCTTCATGGAGGAGGTTATCATCACAAACATATATTTGGGTGAGTCCCCATTACTATGTCAT
      CGTGTCTCCCAACCGATGCTGGATGAACGCGGTGTTTGGATTGATGCCGATGTGACCTACGAGGGATTGGCACACATAAC
      AGTTACTACCAAGCTGAATCTGCTGCGCATACGCAGCAAGACAAAGTCACCAATGGCCACCGATAATGTGCCCACCACCT
      CGATGCTGCCGGAGCAATCACAGGATTTGCGCAGCCTTTCAGAGGTAAATTCGGAGAACGTCATCTATGACAGTGATGCG
      GAGAGCTCGGGCGGTTCATCAACTGAATCCGAGAGCCCACCGCCGGGAAATGCCCCAGAGAATGCGGCTGGAACGGAATT
      TTTTCAGAATTCACCCGGTAATGCGCGTCGCATCTTTAAGATTGTCGACCGCATAGCCGCCTCTAATCTATTTCAATACG
      CCACCGAGCTGCCGTACGTGCAACGAGCTATGGAGAACATGAACGCGAATATCACACTGCGCGTAGATCTCAAGGGTTTG
      GTGGCCCGTGGCACTTTAAATGTGCCACCGCCACCATCCGATCGAGTGTGGGTTAGCTTTCGCGGACCGCCTCGCCTTTG
      GATATCCACCAAGCCCCAAGTGGGCGACAAATCCGTCGATTGGTCCATTGTGACCAATGTTATTGAGAGCAAACTGTGCG
      AGGCTGTAAACAAGTTTCTGGTCTATCCAAATATGGTAGACTTCTCCATACCATTCCTGAGTAACCCCAACTTTGATGAG
      GATCAAGGGAACGCAGCCAACTAAATACCAAAATATAGAGGAAAAGGCAGGGAATAAGAAAAGAGATACAATTTATATTC
      GATGAATTTAACACAAAGTGTGAGCGAGATTTTTTATGTTTACCTTGTTTATTTTTGATATAAACTTCAAGCTTAGATTA
      AATTTTCGATCTCCAGTTCCGGTTTCGAATACTTAATCGCATTAAATGATTGATGAGTACAAGGGACGACCGATTCCGAA
      TGACAAGTTACAAAACGCTTATTTTCATCACATTCTGCTGAAACTCCAGAACAATTCCAATCTTAGCTACAATAATTTTC
      ACCTACAAATATCAAGAAAGTCGCATAAGATGAATATAGCATATTGAATATGCCGCAACAGCCGCTCTGTGAGGTCATCA
      GGACAAGTATTCCAATAGGATAATGCAGGCATCTACAGCTCTATAAGTAATCCACTATTAACGAACAACTACAATATACA
      CACCTATACATATATATTTATATATTCCAAGTAGATTAGTCCTAGAATGCGTGTGAATTTTAAATAAGAAAATCTAATTT
      TATTTGCAGTATGTGGTTATTTGATCGATGATCAACCATAAAATGTATGTACTTAAGCGTTTGTACTATTAAAAAGAACG
      CTACTAAATTATGAAATAGCGGAAATGGATCCGCATATTTTGCCAAATGAGAACGAAACTATTTTCTTGGGTTCCAATTT
      ATACAATAACTACGAAATATCATTTACACGGTTGTTTCCAGGCTACACAACTAAGTAAATCATTTTAGCTCCACGTATAT
      ATAAATATATTTAAAAGTTTTTCATAAATAAATGATAGCAAAGTGCTAGCAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0331517
      4130
      FBtr0331520
      3434
      FBtr0331518
      4988
      FBtr0331519
      4993
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0303906
      887
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0303907
      913
      FBpp0303910
      914
      FBpp0303908
      1221
      FBpp0303909
      1248
      Comments
      Transcript terminates at site supported by polyadenylated cDNA.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG43783-RA
      Secondary FlyBase IDs
        References (0)