Open Close
General Information
Symbol
Dmel\SK-RO
Species
D. melanogaster
Annotation Symbol
CG10706-RO
FlyBase ID
FBtr0331602
Feature type
Associated gene
Evidence Rank
Length (nt)
4946
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 1 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TCAGTATCGCACAAACAACACTAACGGAAACATCAACGTGAAAGCGAGACGGACGCCCTCCGTCCCGTTATATGCTGTGT
          CTGTCTTTAATATATATATAGTTAAACAAAATAAAAATATCAAATAAAAAACAAGTGCAAGCAAAGAGAAAAGCGCCCAA
          TGCGGCCAATGGAAATGCCAAAGAAAATGCAGCAGCTACAAATTCGACAACAAATGCAAATGCGACAGCAACAGCAGAAG
          AAGCAGCAGCAGCAACAACATCAACTGCAATTTCTCAACACATAAGTCCACCGAATTTTCCGTCTTTGTCGCGCGCGCTC
          ACACATATACAAGCACACACATCCATACACGGAGACACATGCATGTGCATAAATGGCAATATGGACGAACAGCAGCAGCA
          TTTGCGTTGTATACCAACACAGTGACACGCGCGTGCCAAATATTGCCGATTTTATCACACGAACAACAACAACAGCAACA
          ACAACACCAGCGGGACCAGCTATTAACTAAAGGAGCCATTACAACAACAATAACAAGATCCAGCAAAGCAACAACAACAA
          CGAAAGCAACGAACATTGCTGGAAGGCGTCGCAAAATATCAAAATGTCAATTCAGAAGCTTAACGACACCACAAACTCGG
          GCTACGTGAGTTCCGAGGAGACGGACTCGCTGCTGGTGAGCAGCTCGAATCCGTCGAAGGGCGGCGGTCGGACGGCTCTG
          CTCCGCCAGGTGAAGAGTAACTCGACAAATGGGCCAACGACGGGGGCGTCCACATCGTCCTCGGGATCGGTATCGGGCGG
          CGGTGGTGGATCCGGTTCCGGTGGCGGATCAGCATCGGGCTCAGCAGCTGGGGCTTCCAAGCCAACGCTAATGCGTCAGG
          ATCGAACATCCACCTACCTGACAAGTCCGCAGCAGTCGCAGCACGCGAGAATGGGTTCCGAGGAGAGCATGCGAGGTGGA
          GCCAGCGGAGCTGCCGGACACGACGAGGATGTGGAACAGGGCCTGGTCCGTAGCAGCATAGTGCCTGATATCGAAGTACA
          CGAAGAGGACCAAGAGCAACACAGCCAGCAGTTAAATGCAACGACGATGGCAACGATGACCAATAACCAACAGCAACAGC
          AACCGACCATATCAATTATGAATTTAAGCCTCAAGCCAGGCGATAGCCATAGCCATAGCTCCAGTCCGGGTAGTCATCCC
          AATTTGGGCACCTCATCATATCAGAATCTGGCATCGAGCATACCGCCCAGCGTACCGAGTCGCTGCAGGGCGTGCCGCAA
          TTGCAGTCGACGTGCTTCCACCACGCCCACCACGCTGATCGATCGCTCCGCCTCCCGCGACAGTGTGAAAAGTGCCTTCC
          AGCAGGGCAATCTTAGCGGCTCCATGGCCATTTGCATATCGAACTCGGCCCTGCCGCAGCAGCAGCAGTTGCAGCAACAG
          TATCACCTGCAACAGCAACAGCAGCAGCACTATCAGTTGCAGCAACACCATCTGCATCAGCAGCAACTGCAGCAGTCGCA
          GCAGCAGGTGCCGCCGGTGCTAATCACATCATCGCCAACGAATGGATCACGGATAATACGGCAAAGTTCACAGCCGGAAT
          CGAGCAGCACGGCCATTTGTTGTGGTCCCCATTCCGCTTGCGTTGGCCACGCCCACTCGCACTCGCACACGGTACCGAAT
          GTTTCGCTGAAGCAGCTGCGCGAGAGTTCCGGCGATGGAATCGCGGGCATTGCAGCCGACTCTCTGCGGATCAACGGTGG
          CATGCGGCCCTTCAAGCAGGGCGTTCTTCTAATGCCTCGCACCTTGTCCGAAAGCCGAAAGTTGCGCCTTCGAAGGGCCT
          TCACCGAGGCCACTAACGAAACACTCCAATGCTCCAAAATGCTCCGCAAACCGGCGTCGACACTCTCAATTCCTGGCTCG
          ATGAAAACACCTTCCATTGCGAACCGGGAACAGATCTCATCTGGATGCAACGAAGAAGCGGCCGAGGCACTAGTGGGTAT
          CCACTCAGACTACCCTAGGTATATGGAAGAACGTGCTCTTACTGGCGGCAATACGTCCAGGAAGCCATCAACAAACTCGG
          CCAAACACAAACCCAATGTGGGCTATCGCCTGGGAAAGAGGAAAGCCCTCTTCGAGAAGCGCAAACGGATCAGCGATTAC
          GCCCTGGTCATGGGCATGTTCGGGATCATCGTGATGGTTATCGAAAACGAACTGAGCAGTGCCGGTGTCTACACAAAGGC
          ATCGTTCTACTCGACAGCGTTAAAAACCTTAATATCTGTTTCGACTGTGATTCTTTTAGGACTTATAGTAGCTTACCATG
          CTTTGGAAGTGCAGGTGAGATTATTCATGATAGATAACTGCGCTGACGATTGGAGGATCGCAATGACATGGCAACGAATT
          AGTCAAATAGGGTTAGAACTTTTTATATGCGCTATACATCCAATTCCTGGCGAATACTATTTCCAGTGGACGACGAAATT
          GGCCAATAAGAATAAAACAATTGGCACCGAAATGGTGCCATATGACGTAGCTTTATCATTACCTATGTTCCTTCGATTAT
          ATTTAATCTGCCGCGTAATGCTGCTGCATTCAAAGCTATTCACAGATGCATCATCACGGAGCATTGGCGCTCTCAATAGG
          ATTAATTTTAACACAAGATTCGTTTTAAAAACTCTAATGACAATATGTCCGGGAACGGTTCTATTGGTCTTCATGGTCTC
          GCTGTGGATCATCGCATCGTGGACGCTGCGTCAGTGCGAAAGATTTCATGATGAAGAACACGCGAATCTTTTGAATGCAA
          TGTGGCTGATAGCGATAACATTTTTGAGTGTTGGTTTCGGTGATATTGTTCCGAATACGTACTGTGGACGTGGTATCGCT
          GTCAGTACAGGAATAATGGGCGCCGGCTGTACGGCTCTACTGGTGGCCGTAGTCTCTCGGAAACTGGAGCTGACCCGTGC
          TGAGAAGCATGTGCACAACTTCATGATGGACACGCAGTTGACGAAACGGCTGAAAAATGCTGCGGCGAATGTTCTGCGTG
          AAACTTGGCTCATTTACAAACATACAAGACTAGTAAAACGGGTTAATCCCGGCCGTGTAAGAACCCACCAAAGAAAGTTC
          CTTCTAGCTATATATGCGTTGCGAAAAGTTAAAATGGATCAGCGCAAACTAATGGATAATGCAAACACAATAACTGACAT
          GGCTAAGACACAAAACACGGTCTACGAGATAATATCGGACATGTCTAGCCGTCAGGATGCCATCGAAGAGCGTTTAACCA
          ACCTAGAGGACAAAATGCAGAGCATACAAGAGCACATGGAAAGCCTTCCAGACCTATTGTCTCGATGTCTGACCCAGCAC
          CAGGAGCGGATCGAGCAGCGGCGGAACTTTTTACATCCTGACACAGCTGCAGTTGCCCCCATTCAAGCGCCAACGCCCCA
          ATCGATGTTCAATGCAGCGCCCATGCTGTTTCCACATTCTAGTTAATAGCTACGCATCTTCCAACAAATACGGCAGCTGA
          ATATCAGAAAGAGAGCGCTCCAACTCCGTGATTAACATCGAGATGCTAACAATAAGGCCGGATCGATTCTGGCCAACCTC
          ATTCGCACCCCAAAAACCAACATCAACATTTACATCAACATCAATGTCTACGTCAAAGTGTAAACCCGAATTCGAAGTGG
          CCGAGACAGCGCTGAGGCAACGCGTGCTATCGCCGTCGTTATCGGAGTTTCAATCGAAATCGCAATCGAGACCATCGTCA
          CAAACGCAAGAGCACATTTTGCAAAGGGAGATCATACCGATGGTACCGATCATACCGATCATACCAGTGATACCGGAGGA
          CGCCGAATCGTTGGGAAACACCAATACGAACAGCAACAGTTCGCCCGATCAGCAGAATGTGCCCATGACTATAAGTACAG
          TACCGCCATCGAGTTCAGCGCCCGCATTCACAGCGACCGGAAGCGGAGGTTCGGTGACCGGAACTAGCGGTGGCATTGTG
          AAATCGATAACGATGAACGAACCGATTACGACGGGGAGCGGCAAGCCGATTGCCTCGAATAAGTTTACTAGGAAAAGAGA
          ACGTGTATGCAATAATAGTAGTTAATAGTAGTAGTCATAGTTATAGTAATAATAGAGGTAAAAGTAATATTAGTAATTCT
          ACAAGTCGAATTTCGAACTCGGCCTTTTGTAAATAAGCCTCTTCGAGATGAGAAAAAAGTCAAATGTTAGCATATACATA
          TTAATATACAGAATACACACACTATGTATCCTATATCTGTATACGGATATATATAGGCCTCCCCACAAAACATCCAAAAA
          GAAAGCAAAAAAACAATAAGCGAAAACCGAACAGAATATATGTATACATATATATGTCATTGTGTAACTTTTTTTTTTTG
          TCTAAGTTTTAGGCTAAACGTATTTGTAATATTTCACCTTGGGCCAAGGCAGCCTGTACATGCATACTAAAATACTTAAC
          ATAATATAGCATGTAGGGGGGAGTGTATGTGTGTGTATGTGCATGGGAGTGTGCGAATGCGAGTGTACAGGACCAGATTG
          GTAAGGAAGTTAGGTCATATGTAGGACATAGATCGTAGGGCACCAGCATGTAGAATCCACGTATATAAACGCTCAGAAAT
          AGCAACAGAAATAGCAATAGCAAACCTTAAAGATCTGGCACCAAAAGTCCATAACAGTAAATTCGTATATCCCTTAAAGA
          ACTGCAACCCCCAGCACTTCCGCTTCCGGTGCAGCGCCAACCAACTGCAAAACATCCACGAACATGGCAAATTCTCGTGT
          CCGTCTGTCTCGAATTTGTGTGCATATATAAATTGTATCCGAAGGATGTGTGTCTGACCTGACTGTGTGTGCGAGGCAAG
          TGAAAGCATAAGCATACGAGGAACCCATTAAAGCCCCCAACAATTATACACAAAACGACGCATAAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0300467
          3729
          FBtr0301949
          3723
          FBtr0301950
          3556
          FBtr0301951
          4813
          FBtr0301952
          3885
          FBtr0301953
          8828
          FBtr0301954
          3484
          FBtr0331603
          8050
          FBtr0331604
          5179
          FBtr0344555
          3729
          FBtr0344556
          8050
          FBtr0344557
          3885
          FBtr0344558
          4813
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0303992
          960
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0289694
          524
          FBpp0291161
          522
          FBpp0291162
          812
          FBpp0291163
          927
          FBpp0291164
          576
          FBpp0291165
          927
          FBpp0291166
          685
          FBpp0303993
          979
          FBpp0303994
          928
          FBpp0310908
          719
          FBpp0310909
          1174
          FBpp0310910
          771
          FBpp0310911
          1122
          Comments
          Transcript terminates at site supported by polyadenylated cDNA.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          SK-RO
          Secondary FlyBase IDs
            References (0)