Open Close
General Information
Symbol
Dmel\CG10803-RB
Species
D. melanogaster
Annotation Symbol
CG10803-RB
FlyBase ID
FBtr0331610
Feature type
Associated gene
Evidence Rank
Length (nt)
2896
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 14 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ATTGTTTTTATCGCGAATTGCCAACGCTCTGTACAAGTGATGTACAACACGAGTTAAATACAAAACAAAACGAACGGATA
        AAAGTTGCACGCTGGGCGAATCGTGACAAAGAGGGCGTGGCAAATCGAAATATAGTATAGATCAAATCCCCAGAAGGCGC
        GGCATAAACGTAATATGCGAAAATCGCTGCCATGAAAAAGGGCAAGGGATCAAGCTCCCTTGGATCGAAGGAATCATCGG
        GGAGACCATCCACGGCAGTCCTGGTGTTCAAGAAGTGCGCTAGATTTGCGGACTCTTCAGAATCGGCGGAGATCCAGCAG
        GACGGCAAGGAGCAACTGCCTGAGAGGCAAGACTCGCTGGATGCCAAGGAATTGGTGGGCATACTAATAGAAGCACAGGA
        CGTGTGGTTAGCCATCCCGCTGACGCATTAAACGGAATATTTAACTTCTAGCTGTGATAAGGAAATTGGTAAACCTGCAG
        GAATGGAAAAAGAGGCGATTAGCAATCAGCCATTAAAGGATGAGCCATCGAAAGATGAACCTAACCAAAGCGAGGGCACT
        GCCATTTCCACCATACCGGCGATTGATAAACTACGTCGCTTCTGCTTTATTGGATCCACGGACGAGCCCGTCTATACCAC
        GCCCGCACTGGATCTTGTTGTCGAGAACAATTTCGCATCGCTAAAGGAACTCTGCTCCCAAGTGAGTGAAGACGAGCTGG
        TCGAGTGCTTGTTGAGCGTTTTGGGCAGCGAACCAAATGAGGAGCAACCTCCCCGACCCGACGAGCCGCTCCTAATCCTG
        GCTGTTTTCTTTACCACGTGCGAAGACGAGAAGAAGCGAAATGCGGTGCGTAATAGATTCACCGACCTGATCACCAGCGA
        ATCGGATCTTCTACTGTTCGTCCAGTTGGTCAAGCGAGTCCAGAAGTTGCTCGAACGTAAAACGCCCTTCAATCGCACAG
        TGCGAAAGGCCGTCCTCAACTGGTATGGCACGAAATCGCTTGATCGCCTTCTCCACTTCTGGTCAATAGGCGATGGAAAT
        CGTTGGCCTGCGCATCGCGATCTACTGTACCGCCTCCATTTTCGGCATGCCAATTTTTTACCGGAAATCATTGCTGCCTT
        AAGGCTGCTCTCATCATCGCCAAAGGAGCTATCGCAGTGGCCTGATTTTTTAACGCCCTTGACCAGCTTTCGCGAAACTA
        TTGAGGGTGTTGTGAAGCTTCGGCTACTCACGGATCCCGAACAGGCTATCTCCATTGTGAAGAAGTTGTCGCTGAGCTGG
        GAGCATGTGCCTTTTCATTTGCTTCACGACCCCAGGCTGGCGCATTTTCTTATTCCACACATGAGCTATGAGCAACTTCT
        TCAGAAATGGCCACGCCTCTCGCGACTTAACTCCCGAGTGCGCCCCTTTGCTGAGCAATTGCTGGATAAGAAGAAGCTTA
        AGGCGAGCAATGTTCCGCCCGTACGTCTGCTGTTGGAGGATATGCGTTTGAGGAAGCCCAAAAAGGTGGTTAATCAGTTG
        GTACTACCTTCGTCACTCAAAAACAAGAATACATTTAAATTCCAGTGTGCAACTACTTCGTTCCAAAAGGCGAGTTTCCT
        GCATAGCGTCTACGAAATATCCTTTGGCCTGAACAAGGCACTCGGTAGGCGACTGCACATTACCCTCAATCTGGAGCAGG
        CCTATCTGGGCAAATACCTTTCTGGTCCATGTCGTTCGCTGAAGTACTTAGACGCCCTGGTGGCATTGGGTTTTGGCTAT
        TTCCGCAGCGACCGAAAGGTGACGGTGGAGTTTTGGCACGACCGCAGTGGCAAATTGAAGGCGTTGCCGTGGACAAATGA
        GATGTCTGTTTCAGAGGCCAAGACCTGTTGCGAGAATCAGAAGGTGGGCAAAGTGAGGCAATCGCTAAATGAAATTCTGT
        TCAGAGCGCTATTGGATATGCAGAATACGTTCGACGTGTTTTTGGTACTAGTGCCGGGTGCCGCGCGAGGAAATCCGGAA
        AATAATTCAAAGTGCTTGGCTGCTCTAATGGATAAGTATCGCGAAAAGCGAAACTCTAATGCTAAATTCATAATGGTGAG
        CCTGCGGCAGCGTCAACGCTCCATGATATATTCCAGCGGACGAAACGAGAACTTGTTAGAGTTGTGCAGCCTGGATAAGC
        ACACACCGCGTTTGATTAACGCATTTGTCCGCAATAAGTTCTACTAGACGGTGAGCTGCATTGCGAATATCGGACGACCC
        ATTTCATCGCACAACTGCAGGCACAAAGCAGTTCCATTTGTTGAAGGACGATGGCCATCGGTTAGTTGCCATCGGCCATC
        TCTCTCGCTTTCATAGATGCCTGGTCGTTCGGTCCTCTCACTCCATTTTCGAATAGCTTTTGTGTAACATATTCATAGGC
        CCTTGGTGTGTAATCGTTGTAGAACCAGGCCACCAACTCAATGCTACATTCATATTTACATACTACTAATTGTAATAGTT
        GCATCCCGGAATCCAGAATTTAAAATTCCTATCGGGCTAGTAAGATATTATCGCTCGTTTTGTGTAATGAAATTGTGTAT
        TAGCATTTGTAATTTTTACTCGATTTGGTGTATTCATTTTGTTAAAATTAAACCGAATCAACTGAACTGAACTTAATCTA
        AATTCAATTTGGATTTAAAACAATCTCAATGAAATCGCAAGCGCAAACAACAACAAAAGAACCGACAAAAAAAAAAAAAA
        AGAAAAACAAATTGCCTTACAAACAAAAATGTTAGTAAAACTTTCATTTTAGTTTAGACTTTTTCAAAAATTGAATACTG
        GAACTGAAACACAATTTATGGCATTTAGATAAAGTTAAAGTTAAATATAAACTAATTGTATGGCCTATGTATTGAATATT
        AATCTAACGTAACATT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0070569
        2794
        FBtr0331611
        2890
        FBtr0331612
        4798
        FBtr0332285
        4744
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0304000
        574
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0070544
        637
        FBpp0304001
        574
        FBpp0304002
        574
        FBpp0304564
        617
        Comments

        UTR(s) based on RNA-Seq data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG10803-RB
        Secondary FlyBase IDs
          References (0)