Open Close
General Information
Symbol
Dmel\CG11151-RB
Species
D. melanogaster
Annotation Symbol
CG11151-RB
FlyBase ID
FBtr0331719
Feature type
Associated gene
Evidence Rank
Length (nt)
1066
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 30 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GCAGTGTAGTGAAAAAAGCGACAATAAAATCGCCGATTGCACGCCTTCTGCTCATTACTTCGCGTTCCGCTCTCAAAGCG
        TAAGCACTTTTCTTTTATTTCTACGACGCACAAGCCCACTGAATATTTTCTTTATTCTTCCGGAAAAACAAAACCGCATA
        CACACAGAAATACCCCCACAACAACAACAACAACAACCATGTCTCTGCAGTCGGACGCCGTTTTCCAAAAGATCATCGAT
        GGACTGAAGGAGAACGAGGCCAAGGCCAAGGCGGTCAACGGTGTGTTCCTGTACAAAATCACCAAGGACGGCAAGGTGGC
        CAAGGAGTGGACTCTGGACTGCAAGAACGCCAAGGCCTACGAGGGACCTGCCCAGGGCATCAAGGTGGACACCACCTTGA
        CGGTCGCCGACGAGGACATGGTTGACATCGCCCTGGGCAAGCTGAACCCCCAGGCTGCCTTCATGAAGGGCAAGCTGAAG
        ATCGCCGGCAACATCATGCTCACCCAGAAGCTGGCGCCGCTCCTGAAGACCGACGCCAAGTTGTAAAAAAGGAGTGATCA
        ACAATAACCCAGCCCAGTTAGCACATTCCTCAACGAGACAGTGTGTGTGTGTTCCCTTTTACACAATTTTTTTTTTTTTT
        CGTGTGTGTAATTTGTAATCTGTATTCGTGTTTTTGTTTCACCACATAATTAATGTTATTTTTGTACGGAAAAACCCGTC
        TACAAAACTAGAAAATAATACATAAGGCGAAAACGACAAATTCCTGTGCACTTTGATACTACAAATGGGTTTTATCGATC
        TTCATCGAGAGCACAAACTCCATGTGCTTCATGCGCCAGAGTGGCTTGAAGAGCACCTTGTACGTTGGCATGGTCGACTC
        CAGCATGGCGGCCAGTGGTCCGTGGACAATGTACTGCAGCGAGATGATGTTCCAGCCAATATCACCGTTGAACGGTCGTT
        GAACAATCACATCGAGATGGTTTAGAATATCAGGATCATCGTACTGGGCATTCGTACAGCGCAGAGCGGAATCCAACATG
        GAGGTGAGATCGTTAGCATATATATC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0073819
        705
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0304108
        115
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0073650
        115
        Comments
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG11151-RB
        Secondary FlyBase IDs
          References (0)