Open Close
General Information
Symbol
Dmel\Trf4-1-RH
Species
D. melanogaster
Annotation Symbol
CG11265-RH
FlyBase ID
FBtr0331723
Feature type
Associated gene
Evidence Rank
Length (nt)
3975
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 22 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ATTAAGAAAGTGTTAATTTGCCTAAAATGTACAAGTACATGTGCGCGATGGCCTGCTGTAAATGTGTCACTTGAATGCTG
        ACAGCATTCAAAGAGGTTTAGTCCCGGCAGCGACTTTAATTAATTTTTCCCTGTGGAGCACAAAGATCACATCGGATCTA
        TATAGAGTCACGTCTATATATTCAGACCACCAGGACGCAGAGGATAGAGGTGAAAGGACGAAGCGAAGGAGAGACGCGCG
        CCCCCCTCGTTTCCCGCCCAGCCAACAGCCGTGTGAACCCGTCTTGAATGGATCCATTTGTTGGCTGGTTTCAGAAGGAA
        CAGGAGGGACCATCGCTGTGCACATGGTTAAAGATTTGGGAGACGAATGCCCAAGAGATGGGCGCATTGCTTAATCAACA
        GCTACAGCAGGCGACGACGATCAACGGGAGCACGAGCAGCAGCAGCAGCAGCAGCAATAGTGGTAACAACAACAACAACA
        ACAACAATAACATCATCAATAACACTATCACCAACACGACCAATAACACTGGTAACAATTCATCGGCCAAACCCTACTTA
        TCGCGACCCTACAGCTCGCTAAATCGGGTGCTCAATTTCCGAGCGGATTCCCTGGAGATCCTGCAGCAGCAACAACAACA
        GCAGCAGCTCAACGGGACCACTCAGCGCAACAGCACCAACATCAATACCACAAGCGGCGGCAGCACTAGCTCGTCGGCAG
        ATTCCACCACGAATCGGGACAATAACTCACCCGCCAATAGCAGTTCAACCAACGGACCCGGAGCAGGAACGGGAACGTCA
        ACAGGAGCAGGAGGTACCGGTACAAATAGTCCGGCGACGACAGCGTCAAGCACAGCTGCGACCACGACTGGTCCAGCCAC
        TAGTATGAGCGACACCAGCAACAACCCGCCACAATCAACGACCACGCCCGCCAGCCGCACGAACAGCATCTACTACAATC
        CATCGCGGAAGAAACGACCGGAGAACAAGGCTGGCGGAGCCCACTACTATATGAACAACCATATGGAGATGATCGCCAAG
        TACAAGGGCGAACCGTGGCGCAAGCCGGACTATCCGTATGGCGAGGGCGTTATCGGGCTGCACGAGGAGATCGAGCATTT
        CTATCAGTACGTCCTGCCCACGCCCTGCGAACACGCCATCCGCAACGAGGTGGTCAAGCGTATCGAGGCCGTTGTCCATT
        CCATCTGGCCACAGGCAGTAGTCGAGATCTTTGGCTCCTTTCGCACTGGCCTCTTTTTGCCCACCTCCGACATAGATCTC
        GTTGTGTTAGGTTTGTGGGAGAAGCTGCCGCTGAGAACGCTGGAGTTCGAGCTAGTGAGCCGTGGTATCGCCGAGGCTTG
        TACGGTGCGTGTTCTGGACAAGGCATCAGTGCCCATCATCAAGCTGACGGACCGGGAAACGCAAGTGAAGGTAGACATAT
        CGTTCAACATGCAGAGTGGTGTTCAGTCGGCGGAGCTGATTAAGAAGTTTAAGCGCGACTATCCAGTGCTGGAGAAGCTA
        GTGCTTGTGCTGAAGCAGTTCTTACTACTTCGCGATCTCAACGAGGTGTTCACGGGCGGCATCTCCTCCTACTCGCTGAT
        CCTTATGTGCATCAGCTTCCTGCAGATGCATCCGCGCGGTATCTACCACGATACAGCCAATCTGGGGGTGCTTCTCCTCG
        AGTTCTTCGAACTTTATGGACGTCGCTTCAACTACATGAAGATCGGCATCTCCATAAAGAACGGTGGCCGCTACATGCCC
        AAGGATGAGCTGCAGCGTGACATGGTCGATGGCCATCGACCCTCGCTCCTGTGCATCGAGGATCCGCTGACGCCAGGCAA
        TGATATCGGTCGAAGCAGCTACGGCGTCTTCCAGGTGCAACAGGCATTCAAGTGCGCCTACCGCGTGCTCGCCCTTGCCG
        TCAGTCCGCTCAACCTTCTCGGCATCGATCCGCGCGTCAACTCGATACTGGGTCGAATCATTCACATCACCGACGACGTG
        ATCGATTATCGCGAATGGATCCGCGAGAACTTCGAACATCTGGTGGTGGTGGATCGTATCTCGCCGCTGCCCACTGCCGC
        TCCCACTGCGTACGCCACCGCCAATGGGGCGCCAAAATATGTGATTATGCCCTCGGGCGCCGTTGTCCAGCAGCTGTACC
        ATCATCCGGTGCAGGTGCCCACCGCTCACGGGCACAGCCATGCGCACAGCCACAGTCACGGGCACGCGCATCCTGGCGCC
        CATCTGTGCCAGCCGTATGTGACCGGGACCACTGTATCTGCTGTAACGACGACTACAACGATGGCGGTGGTGACCGTGGG
        CGTGTCAGCCGGCGGAGTCCAACAGCAGCAACAGCAACAGAATGCGACGGCCCATACCCACTCGCAACAGCAGACACAGA
        ACCAATCGCAGTCGCGCCATAGACGCGGCAGCACCTCGTCGGGCGATGACTCCGAGGATAGCAAGGACGGCGATGTTGTC
        GAGACGACGTCGAGTGCTCAGGAGGTCGTTGACATCGCGCTATCGACGCCAAATGGCCTGGCCAACATGTCCATGCCCAT
        GCCAGTGCATGCTGTCGGAATGCCTGCGTCGAACAGTTGGAGCGGTAATGGCAATGGAAACGGAAACAGCAGCTCATCCA
        CGGGCTCGTCGCCGGAAATCGCACACATCGCTGCCCAGGAAATGGACCCCGAGCTTGAGGATCAACAGCAACAACAGCAG
        CACCAAGAGACTTCTGGAGGTAATGGCTTCATCCGACCGGGTGACGTCGGCACCGGTTCCAACAGGGGAGGCGGTGACGG
        CAGTGGCGGCCGCAATTACAACCAGCGGAACAACCACAACTCCAGCGGCTACTACCACCAGCAGTACTACGTGCCACCGC
        CGATGCAACAGCAGCTGAGCAAGTCCAACTCCTCCTCCAACTATCACCAGCAACACCATCACAGCCACAGCCATGGCAAT
        CATAGTCACCGACAACAGCATCACCACCAGCAGCAGCACCACCACCAGCAGCGGCCGCAGCATCTGCGTGTGGGCGGCGG
        CAATCGATACCAGAAATCGTTGGGCGGATCGCCCATCATCAGTGCTGGCAATGCGTCGAACAGCAGCAGTAATTGCAGCA
        ACAGCAGCAGCAGCAGCGGCAGCAACAACAGCCGACTGCCGCCGCTAAGGGGCACGCTGGTCAACTCATCGTCAGCAATA
        TCAATCATTTCCATATCCTCAGAATCATCCATTGCTAGCAGCAGCTCCAGTTCGTCAAGATCCGGTCAGGATCAGCAGCG
        TGACGAGCGATAGGAATAGGATGTAGGAAGATATTGTGTATGTCTATGACACAGAGAGAAAGAGAGTGCGACACAGAGGG
        ACAGAGAATGAGAGAGAAAGAGATAGTTACGGTGTTAGCAATATTTATGGGTTACATTTCTTTCTCAGGTTAATTGTAAA
        CTACGCTGCATTTTTCTAATAAATATCATTGACCCCCCCGCCCCCCCGCCTCTACCTAATCCGAAAGCATCTCCTCAACC
        AATGTAACTGCGATCAGATTTTCTTTTACACTGCTGTCTTGCTTAAATTGGGAGAGCGACGCAGACCTACTAAGCCTAGT
        GTTAGGAACTTTGCCTCTGATCGCGCTAAATGTATTTCAGTTTGTTTCTAAAATAAACATGAAAGCAAAGAATATATATA
        TATATATATATATATATTTATATATATAGATATATATTAAATTAAATTAAATTGTACCATAAGCATAACTGTTAGCTCAT
        AAGTAGATTGTAAGGGTTTAAAAGATCGATAAACTGAAGTATGAAATTATGCTAATCTCTTTTCCCATACCCCCCCCCCC
        CCCTTTTTATCCATCATCATGCGCATTCAAGCTTCTAAAGTATTTTGTAGTTTCTGAAATGCTCTCCGTCTAGTGCAATG
        GTAAACATTTTTGCAAACGTAACTAATTCCCTATCCACCCCATTTCCTGCCATAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0071212
        4205
        FBtr0071213
        4400
        FBtr0112963
        3981
        FBtr0112964
        6507
        FBtr0331724
        4238
        FBtr0331725
        6812
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0304112
        1001
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0071158
        1001
        FBpp0071159
        1001
        FBpp0111876
        802
        FBpp0111877
        802
        FBpp0304113
        1001
        FBpp0304114
        1001
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        Trf4-1-RH
        Secondary FlyBase IDs
          References (0)