Open Close
General Information
Symbol
Dmel\Alr-RB
Species
D. melanogaster
Annotation Symbol
CG12534-RB
FlyBase ID
FBtr0331763
Feature type
Associated gene
Evidence Rank
Length (nt)
1362
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 79 )
Sequence
AGATCACACAGAGCTTTTGCAAATTATGTCACAGATCAGATTTTAACGCTGTAAATGTAGAAGTTTACGGAAAAGTCTTA
AAAAAAAATTTTATTGTGTACGTTAAAAATTTGGATCAGAAAAATCAATAAATATTGCCAATAGCATATGTGTTATTCTA
TTTTAAACAGTTCCAAGGCGCAAAATTTATCTGGGGCTGCAGCACTCACAAACGCCAGCTTCCATCCTATTCACATGTGG
CAACCATGCGCATGCTTTTTATGATTTTCACAATAGCCGAGCGAAGTTTCAAGATTCTAGAACTACCCACCACACCAACG
CTTCTGCTGCGCCGCCAGTCCCACAACTACGGCTACGACTACATCAGCCCCACGCACATCGAACTCAGCCGGGAAGCAAC
TCGCCTGGTAATTCGCCGTCTGCAGCGCACCGTTCTCCGCCTGATCCGTGACCCGGACTTCATCATGTCTGCCGAGGCGA
ATCCCGAGATGGATAAGGAGCACCACGAGTCCCCATTCGCAGCGAACCGCAAGGCCGGTGCCAGCGGCGCCGGCAAACAG
GACTCGAACTGCCGCACCTGCAACGATTTCAAGTCGTGGTCCAAGCAGCAACGCCTCATCTCCAACGTGCAGAGCGCCAA
GGTGAAGCACATGGCCGCCGCCGAAAAGCTGACCGTCAACGCCGCCGAAGATCCGCTGCCCCGCGACGACTGCCCGCTGG
ACAAGGTGAGGCTGGGAATTTCCACCTGGGGACTGCTCCACACCATGGCCGCCTTTTACTCGGACAACCCCACGGACACC
GAGAAGCGCGACATGAAGACCTTTTTTGAGGTTCTGTCGCGCCTTTACCCCTGCGAGTTTTGCGCCAAGGACTTTCGCAC
CGACCTGGACGTCAACCCCATCAATGTGAACTCCCAAAAGGAGCTAGCACTGTGGCTGTGCAAGTTCCACAACCGAGTGA
ACGACAAACTGGGCAAACCGCTCTTCGATTGCACCAAGGTGAACGAGAGGTGGCGCGACGGCTGGCTAGACGGCTCCTGC
GACTAGGCGCCGCAGCTAACCAGCGCCGAGAAGCCCCGTCTCCCGCCCGTTGCAGGTTGCCATGTTGACCAGACTTTGTC
CCACATTTTGCTCGGCTGGCCCACAACTACAACCACGGAACACGGGACTCCTGCTCGGCGGTGTACCGCCGCCAACCCGA
AACTGTGCCCTGTTTCTGGCCAGAGGCCATGCCCACCAGTCGGAACCTGCGTCAGCGTGACATTAAATTGAGTTATGTTG
TAATAGAGCGACACATCGAAGGTCCATTGTTAAATGATTTGCTGGCTATGAACTCCATTAGAATATACACATTATGTTGA
GG
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0074794
1107
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0304151
266
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0074563
261
Comments

Transcriptional initiation is supported by RAMPAGE TSS data (FBrf0220331).

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
Alr-RB
Secondary FlyBase IDs
    References (0)